Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633673_a_at:

>probe:Drosophila_2:1633673_a_at:605:593; Interrogation_Position=327; Antisense; TGGGAGAAAATACCGTGCGCACTAT
>probe:Drosophila_2:1633673_a_at:43:355; Interrogation_Position=345; Antisense; GCACTATCGCCATGGATGGTACCGA
>probe:Drosophila_2:1633673_a_at:177:487; Interrogation_Position=363; Antisense; GTACCGAAGGCTTGGTTCGCGGACA
>probe:Drosophila_2:1633673_a_at:605:25; Interrogation_Position=399; Antisense; ATACTGGGTATCCTATCCGAATTCC
>probe:Drosophila_2:1633673_a_at:334:45; Interrogation_Position=413; Antisense; ATCCGAATTCCAGTTGGTGCCGAAA
>probe:Drosophila_2:1633673_a_at:539:319; Interrogation_Position=431; Antisense; GCCGAAACACTAGGACGCATCATTA
>probe:Drosophila_2:1633673_a_at:434:381; Interrogation_Position=520; Antisense; GAACCCATTGATGAGCGTGGACCAA
>probe:Drosophila_2:1633673_a_at:437:213; Interrogation_Position=556; Antisense; AAGACCGCTGCCATTCATGCTGAGG
>probe:Drosophila_2:1633673_a_at:400:51; Interrogation_Position=572; Antisense; ATGCTGAGGCTCCTGAATTCGTTCA
>probe:Drosophila_2:1633673_a_at:671:365; Interrogation_Position=629; Antisense; GAATCAAAGTCGTCGATCTCCTGGC
>probe:Drosophila_2:1633673_a_at:344:567; Interrogation_Position=651; Antisense; GGCTCCATACGCCAAAGGTGGTAAA
>probe:Drosophila_2:1633673_a_at:599:117; Interrogation_Position=747; Antisense; AGCTCATGGTGGATACTCGGTTTTC
>probe:Drosophila_2:1633673_a_at:520:411; Interrogation_Position=855; Antisense; GACCTCAAAGGTGGCTCTCGTATAT
>probe:Drosophila_2:1633673_a_at:485:357; Interrogation_Position=882; Antisense; GCAAATGAACGAGCCGCCAGGTGCT

Paste this into a BLAST search page for me
TGGGAGAAAATACCGTGCGCACTATGCACTATCGCCATGGATGGTACCGAGTACCGAAGGCTTGGTTCGCGGACAATACTGGGTATCCTATCCGAATTCCATCCGAATTCCAGTTGGTGCCGAAAGCCGAAACACTAGGACGCATCATTAGAACCCATTGATGAGCGTGGACCAAAAGACCGCTGCCATTCATGCTGAGGATGCTGAGGCTCCTGAATTCGTTCAGAATCAAAGTCGTCGATCTCCTGGCGGCTCCATACGCCAAAGGTGGTAAAAGCTCATGGTGGATACTCGGTTTTCGACCTCAAAGGTGGCTCTCGTATATGCAAATGAACGAGCCGCCAGGTGCT

Full Affymetrix probeset data:

Annotations for 1633673_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime