FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633675_at:

>probe:Drosophila_2:1633675_at:336:151; Interrogation_Position=342; Antisense; ACATCTTTTGGAAGTGCCGCGACAT
>probe:Drosophila_2:1633675_at:689:327; Interrogation_Position=391; Antisense; GCGGTACTACAACTTGGCCTACTTT
>probe:Drosophila_2:1633675_at:688:181; Interrogation_Position=477; Antisense; AAAACCAGGTGTCCAAGCTGCACAT
>probe:Drosophila_2:1633675_at:376:207; Interrogation_Position=491; Antisense; AAGCTGCACATCTTTCATCACTTCT
>probe:Drosophila_2:1633675_at:209:661; Interrogation_Position=522; Antisense; TAACGCTGGTCTACGCACTGATCAA
>probe:Drosophila_2:1633675_at:71:185; Interrogation_Position=555; Antisense; AAAATGGTTCTGCTGCTTACTTCTG
>probe:Drosophila_2:1633675_at:26:343; Interrogation_Position=569; Antisense; GCTTACTTCTGCGTGTTCTTGAATT
>probe:Drosophila_2:1633675_at:389:669; Interrogation_Position=614; Antisense; TACTCGTACTACTTTGTGGCGGCAG
>probe:Drosophila_2:1633675_at:365:543; Interrogation_Position=643; Antisense; GGATAAGACCTTGGTGCAGGCCCTA
>probe:Drosophila_2:1633675_at:549:347; Interrogation_Position=658; Antisense; GCAGGCCCTAACTCCAGTGAAGAAG
>probe:Drosophila_2:1633675_at:146:57; Interrogation_Position=701; Antisense; ATGACGCAGTTCGTTCTTATCCTCA
>probe:Drosophila_2:1633675_at:663:719; Interrogation_Position=737; Antisense; TTCCAGCTGGTATTGTGCGGCATGC
>probe:Drosophila_2:1633675_at:246:713; Interrogation_Position=795; Antisense; TTCTTGGCATGTTCTACGGCTTTTA
>probe:Drosophila_2:1633675_at:391:655; Interrogation_Position=829; Antisense; TAATAGTGCCTATCAAGCCTCGCAG

Paste this into a BLAST search page for me
ACATCTTTTGGAAGTGCCGCGACATGCGGTACTACAACTTGGCCTACTTTAAAACCAGGTGTCCAAGCTGCACATAAGCTGCACATCTTTCATCACTTCTTAACGCTGGTCTACGCACTGATCAAAAAATGGTTCTGCTGCTTACTTCTGGCTTACTTCTGCGTGTTCTTGAATTTACTCGTACTACTTTGTGGCGGCAGGGATAAGACCTTGGTGCAGGCCCTAGCAGGCCCTAACTCCAGTGAAGAAGATGACGCAGTTCGTTCTTATCCTCATTCCAGCTGGTATTGTGCGGCATGCTTCTTGGCATGTTCTACGGCTTTTATAATAGTGCCTATCAAGCCTCGCAG

Full Affymetrix probeset data:

Annotations for 1633675_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720