FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633677_at:

>probe:Drosophila_2:1633677_at:213:251; Interrogation_Position=499; Antisense; CAATGGTGGCAAGCCTCTGTCGGAA
>probe:Drosophila_2:1633677_at:651:285; Interrogation_Position=515; Antisense; CTGTCGGAATTCTTTGGCCTGATGA
>probe:Drosophila_2:1633677_at:516:615; Interrogation_Position=606; Antisense; TGAAGGCCTTTATGCGTCACTGGTG
>probe:Drosophila_2:1633677_at:57:495; Interrogation_Position=621; Antisense; GTCACTGGTGTCTCAAGGAGGCGTA
>probe:Drosophila_2:1633677_at:341:251; Interrogation_Position=649; Antisense; CAAGGAGCTGGGTGTTGGCATCACT
>probe:Drosophila_2:1633677_at:429:97; Interrogation_Position=687; Antisense; AGATCAGCTTCTCAGTGGACACTAC
>probe:Drosophila_2:1633677_at:314:267; Interrogation_Position=699; Antisense; CAGTGGACACTACTCGCAGTTTGGA
>probe:Drosophila_2:1633677_at:614:479; Interrogation_Position=717; Antisense; GTTTGGAGACAGATGTTTCCCCTCT
>probe:Drosophila_2:1633677_at:296:605; Interrogation_Position=741; Antisense; TGATCGGTACTAGTCTGCGTTGCCA
>probe:Drosophila_2:1633677_at:209:397; Interrogation_Position=779; Antisense; GACAATTGGCATTTCGAGGAGCATT
>probe:Drosophila_2:1633677_at:240:619; Interrogation_Position=807; Antisense; TGCAGGAGGACTACTGTGCGGCCAT
>probe:Drosophila_2:1633677_at:531:7; Interrogation_Position=830; Antisense; ATTGCATTCCGGAATTGCTTGCCAC
>probe:Drosophila_2:1633677_at:255:437; Interrogation_Position=923; Antisense; GAGGAAGTGATCAGCTACTGCCAAA
>probe:Drosophila_2:1633677_at:249:711; Interrogation_Position=957; Antisense; TTAAGCCCTACAAGCGATCATGATG

Paste this into a BLAST search page for me
CAATGGTGGCAAGCCTCTGTCGGAACTGTCGGAATTCTTTGGCCTGATGATGAAGGCCTTTATGCGTCACTGGTGGTCACTGGTGTCTCAAGGAGGCGTACAAGGAGCTGGGTGTTGGCATCACTAGATCAGCTTCTCAGTGGACACTACCAGTGGACACTACTCGCAGTTTGGAGTTTGGAGACAGATGTTTCCCCTCTTGATCGGTACTAGTCTGCGTTGCCAGACAATTGGCATTTCGAGGAGCATTTGCAGGAGGACTACTGTGCGGCCATATTGCATTCCGGAATTGCTTGCCACGAGGAAGTGATCAGCTACTGCCAAATTAAGCCCTACAAGCGATCATGATG

Full Affymetrix probeset data:

Annotations for 1633677_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720