FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633680_at:

>probe:Drosophila_2:1633680_at:712:607; Interrogation_Position=368; Antisense; TGAGAAGCAGATCGGCTACCTCACC
>probe:Drosophila_2:1633680_at:701:673; Interrogation_Position=384; Antisense; TACCTCACCTACTTGGGCCAGGACA
>probe:Drosophila_2:1633680_at:596:579; Interrogation_Position=399; Antisense; GGCCAGGACACCAATGAAGCTTTGA
>probe:Drosophila_2:1633680_at:423:505; Interrogation_Position=426; Antisense; GTGCGCAGCTGGTACGAGTTAGCCC
>probe:Drosophila_2:1633680_at:391:529; Interrogation_Position=469; Antisense; GGGATCCCACAGCTACTGAAACTCA
>probe:Drosophila_2:1633680_at:133:659; Interrogation_Position=497; Antisense; TAAGCAAAAGCTAGCCCACGATCCT
>probe:Drosophila_2:1633680_at:604:447; Interrogation_Position=516; Antisense; GATCCTCTGACCCTAATTAATGCTT
>probe:Drosophila_2:1633680_at:214:13; Interrogation_Position=531; Antisense; ATTAATGCTTTGTTGCCGCCAGAAA
>probe:Drosophila_2:1633680_at:142:649; Interrogation_Position=611; Antisense; TCAGGAACCTTCAATACCCCACAAG
>probe:Drosophila_2:1633680_at:199:689; Interrogation_Position=698; Antisense; TTTGGCCGAGGAACGCATAAAACGA
>probe:Drosophila_2:1633680_at:616:199; Interrogation_Position=772; Antisense; AACGCCAGCGTTCCGAGGCTCTGTT
>probe:Drosophila_2:1633680_at:548:603; Interrogation_Position=793; Antisense; TGTTCGCACCCAAGGAGCTGCCGGT
>probe:Drosophila_2:1633680_at:397:341; Interrogation_Position=843; Antisense; GCTTCGACGCCTAAGGTTGTCCAAA
>probe:Drosophila_2:1633680_at:530:261; Interrogation_Position=875; Antisense; CAGTCAGTTTAATCCGGAGTTAGCA

Paste this into a BLAST search page for me
TGAGAAGCAGATCGGCTACCTCACCTACCTCACCTACTTGGGCCAGGACAGGCCAGGACACCAATGAAGCTTTGAGTGCGCAGCTGGTACGAGTTAGCCCGGGATCCCACAGCTACTGAAACTCATAAGCAAAAGCTAGCCCACGATCCTGATCCTCTGACCCTAATTAATGCTTATTAATGCTTTGTTGCCGCCAGAAATCAGGAACCTTCAATACCCCACAAGTTTGGCCGAGGAACGCATAAAACGAAACGCCAGCGTTCCGAGGCTCTGTTTGTTCGCACCCAAGGAGCTGCCGGTGCTTCGACGCCTAAGGTTGTCCAAACAGTCAGTTTAATCCGGAGTTAGCA

Full Affymetrix probeset data:

Annotations for 1633680_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720