FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633681_at:

>probe:Drosophila_2:1633681_at:363:481; Interrogation_Position=5082; Antisense; GTATCGAACATTTTCCAACCGGGCT
>probe:Drosophila_2:1633681_at:528:251; Interrogation_Position=5097; Antisense; CAACCGGGCTTACATGCTAAATTCC
>probe:Drosophila_2:1633681_at:559:663; Interrogation_Position=5114; Antisense; TAAATTCCAATTTGACTCCATCCCC
>probe:Drosophila_2:1633681_at:241:421; Interrogation_Position=5140; Antisense; GAGCAACAAGCCCTCCAAGTATTTC
>probe:Drosophila_2:1633681_at:197:309; Interrogation_Position=5154; Antisense; CCAAGTATTTCCCATACGGAGAGAA
>probe:Drosophila_2:1633681_at:461:481; Interrogation_Position=5216; Antisense; GTATTACTTTTCCTTCAATCCACTC
>probe:Drosophila_2:1633681_at:460:355; Interrogation_Position=5244; Antisense; GCACTGCTCACGATCAATTCAACAT
>probe:Drosophila_2:1633681_at:74:191; Interrogation_Position=5264; Antisense; AACATATTATATCCCTTCGGCCGCT
>probe:Drosophila_2:1633681_at:166:289; Interrogation_Position=5281; Antisense; CGGCCGCTTCCAGTGTTATGTTTAA
>probe:Drosophila_2:1633681_at:629:475; Interrogation_Position=5300; Antisense; GTTTAAGCCGTTCAACTGATTTTGT
>probe:Drosophila_2:1633681_at:687:301; Interrogation_Position=5440; Antisense; CCCCGCAAACGGTAAATCTCATGAA
>probe:Drosophila_2:1633681_at:177:59; Interrogation_Position=5533; Antisense; ATGTATGTGAGCTCGCAACTTTATA
>probe:Drosophila_2:1633681_at:429:111; Interrogation_Position=5558; Antisense; AGCAATGTTTAGACGCAGGAATTTC
>probe:Drosophila_2:1633681_at:5:199; Interrogation_Position=5603; Antisense; AACGACTTATAGAGTTGCAAGCACA

Paste this into a BLAST search page for me
GTATCGAACATTTTCCAACCGGGCTCAACCGGGCTTACATGCTAAATTCCTAAATTCCAATTTGACTCCATCCCCGAGCAACAAGCCCTCCAAGTATTTCCCAAGTATTTCCCATACGGAGAGAAGTATTACTTTTCCTTCAATCCACTCGCACTGCTCACGATCAATTCAACATAACATATTATATCCCTTCGGCCGCTCGGCCGCTTCCAGTGTTATGTTTAAGTTTAAGCCGTTCAACTGATTTTGTCCCCGCAAACGGTAAATCTCATGAAATGTATGTGAGCTCGCAACTTTATAAGCAATGTTTAGACGCAGGAATTTCAACGACTTATAGAGTTGCAAGCACA

Full Affymetrix probeset data:

Annotations for 1633681_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720