FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633683_at:

>probe:Drosophila_2:1633683_at:620:363; Interrogation_Position=122; Antisense; GAATTACAACGCCATCCCGTCGAGG
>probe:Drosophila_2:1633683_at:270:123; Interrogation_Position=167; Antisense; AGCGACTCCGACATCTTCAAATGGG
>probe:Drosophila_2:1633683_at:124:29; Interrogation_Position=223; Antisense; ATACGAGGGCGGCTTCTTCAAGGCT
>probe:Drosophila_2:1633683_at:299:605; Interrogation_Position=252; Antisense; TGATCTTCCCCAAAGAGTACCCACT
>probe:Drosophila_2:1633683_at:226:625; Interrogation_Position=276; Antisense; TGCGCCCGCCCAAGATGAAGTTCAT
>probe:Drosophila_2:1633683_at:497:93; Interrogation_Position=294; Antisense; AGTTCATCACCGAAATCTGGCATCC
>probe:Drosophila_2:1633683_at:340:397; Interrogation_Position=326; Antisense; GACAAGGCCGGCGACGTTTGCATCT
>probe:Drosophila_2:1633683_at:623:47; Interrogation_Position=353; Antisense; ATCCTCCACGAACCTGGTGACGATA
>probe:Drosophila_2:1633683_at:706:583; Interrogation_Position=426; Antisense; TGGAGACGATCCTTCTTTCCGTTAT
>probe:Drosophila_2:1633683_at:337:53; Interrogation_Position=455; Antisense; ATGCTCACCGATCCCAATGACGAGT
>probe:Drosophila_2:1633683_at:235:677; Interrogation_Position=581; Antisense; TAGACCGGATAGACTGGGCAGTGAC
>probe:Drosophila_2:1633683_at:148:561; Interrogation_Position=616; Antisense; GGAACGGCACACATGCTAATCACGT
>probe:Drosophila_2:1633683_at:439:509; Interrogation_Position=72; Antisense; GTGACATGTCCGAACTGCAAGCATC
>probe:Drosophila_2:1633683_at:93:617; Interrogation_Position=87; Antisense; TGCAAGCATCGCTACTGCTCAATCG

Paste this into a BLAST search page for me
GAATTACAACGCCATCCCGTCGAGGAGCGACTCCGACATCTTCAAATGGGATACGAGGGCGGCTTCTTCAAGGCTTGATCTTCCCCAAAGAGTACCCACTTGCGCCCGCCCAAGATGAAGTTCATAGTTCATCACCGAAATCTGGCATCCGACAAGGCCGGCGACGTTTGCATCTATCCTCCACGAACCTGGTGACGATATGGAGACGATCCTTCTTTCCGTTATATGCTCACCGATCCCAATGACGAGTTAGACCGGATAGACTGGGCAGTGACGGAACGGCACACATGCTAATCACGTGTGACATGTCCGAACTGCAAGCATCTGCAAGCATCGCTACTGCTCAATCG

Full Affymetrix probeset data:

Annotations for 1633683_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720