FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633684_at:

>probe:Drosophila_2:1633684_at:648:209; Interrogation_Position=1000; Antisense; AAGCACGGCTCCTTTTGCGTGGAGA
>probe:Drosophila_2:1633684_at:214:425; Interrogation_Position=1021; Antisense; GAGACGGAGAAGTTCCCCGATGCAA
>probe:Drosophila_2:1633684_at:677:353; Interrogation_Position=1098; Antisense; GCACGATGTCCTCTACTGGTTTAAG
>probe:Drosophila_2:1633684_at:189:505; Interrogation_Position=1131; Antisense; GTCCTGGAAGTGCTGTTGCAACAAC
>probe:Drosophila_2:1633684_at:109:33; Interrogation_Position=1161; Antisense; ATAAGTGTCGTCGTGATCTCTCGTC
>probe:Drosophila_2:1633684_at:539:7; Interrogation_Position=1176; Antisense; ATCTCTCGTCAATAAAGTCCAACCC
>probe:Drosophila_2:1633684_at:185:443; Interrogation_Position=1211; Antisense; GATGTTTTGTTTAGCTACTCGTATT
>probe:Drosophila_2:1633684_at:577:139; Interrogation_Position=697; Antisense; ACGGACGAGCTGCAGATTCCCACGG
>probe:Drosophila_2:1633684_at:431:109; Interrogation_Position=725; Antisense; AGCTAGTCGACGTCAAGGACACCGT
>probe:Drosophila_2:1633684_at:383:225; Interrogation_Position=739; Antisense; AAGGACACCGTCTTTGATCTCAGGC
>probe:Drosophila_2:1633684_at:610:325; Interrogation_Position=779; Antisense; GCGACCGACTCATGCAGTTCGAAAA
>probe:Drosophila_2:1633684_at:677:295; Interrogation_Position=822; Antisense; CGACAACTGCTTCGTGGTCAACGGA
>probe:Drosophila_2:1633684_at:497:539; Interrogation_Position=934; Antisense; GGTATGCAGTTCTACACCGCGAACA
>probe:Drosophila_2:1633684_at:712:181; Interrogation_Position=955; Antisense; AACAATCTTACCTCGATAGTGGGCA

Paste this into a BLAST search page for me
AAGCACGGCTCCTTTTGCGTGGAGAGAGACGGAGAAGTTCCCCGATGCAAGCACGATGTCCTCTACTGGTTTAAGGTCCTGGAAGTGCTGTTGCAACAACATAAGTGTCGTCGTGATCTCTCGTCATCTCTCGTCAATAAAGTCCAACCCGATGTTTTGTTTAGCTACTCGTATTACGGACGAGCTGCAGATTCCCACGGAGCTAGTCGACGTCAAGGACACCGTAAGGACACCGTCTTTGATCTCAGGCGCGACCGACTCATGCAGTTCGAAAACGACAACTGCTTCGTGGTCAACGGAGGTATGCAGTTCTACACCGCGAACAAACAATCTTACCTCGATAGTGGGCA

Full Affymetrix probeset data:

Annotations for 1633684_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720