FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633686_at:

>probe:Drosophila_2:1633686_at:715:217; Interrogation_Position=1785; Antisense; AAGTACGGCATTCCAATCTTCTCGT
>probe:Drosophila_2:1633686_at:256:95; Interrogation_Position=1828; Antisense; AGTTGTGCAAGTGCATCACCGCCGG
>probe:Drosophila_2:1633686_at:450:645; Interrogation_Position=1855; Antisense; TCTTCACACAGGTGGCCTATCTGCA
>probe:Drosophila_2:1633686_at:156:305; Interrogation_Position=1870; Antisense; CCTATCTGCATCACTCTGGAGTTTA
>probe:Drosophila_2:1633686_at:646:703; Interrogation_Position=1892; Antisense; TTATAGACAAATCAGCAGCGGCACT
>probe:Drosophila_2:1633686_at:479:121; Interrogation_Position=1908; Antisense; AGCGGCACTGAACTGGCCATTCATC
>probe:Drosophila_2:1633686_at:710:717; Interrogation_Position=1954; Antisense; TTCCTCAAGCTCAGTACGTGGTCTA
>probe:Drosophila_2:1633686_at:635:525; Interrogation_Position=1981; Antisense; GGGAACTGCTCCAAACGACGAAATT
>probe:Drosophila_2:1633686_at:165:7; Interrogation_Position=2003; Antisense; ATTGTTCATGAACTACGTGACCGTA
>probe:Drosophila_2:1633686_at:364:581; Interrogation_Position=2053; Antisense; TGGCGCCGCATTATTACCAACAGAC
>probe:Drosophila_2:1633686_at:34:517; Interrogation_Position=2118; Antisense; GTGTGAAACGATGCCGCCTCTTGAA
>probe:Drosophila_2:1633686_at:280:727; Interrogation_Position=2187; Antisense; TTGTGTGTTTAACCAGCGGCGACGC
>probe:Drosophila_2:1633686_at:491:25; Interrogation_Position=2235; Antisense; ATAGACTCGGGTCCACGGATGACAC
>probe:Drosophila_2:1633686_at:657:281; Interrogation_Position=2270; Antisense; CTCCCAGCACATTTTGGCGGGCAAA

Paste this into a BLAST search page for me
AAGTACGGCATTCCAATCTTCTCGTAGTTGTGCAAGTGCATCACCGCCGGTCTTCACACAGGTGGCCTATCTGCACCTATCTGCATCACTCTGGAGTTTATTATAGACAAATCAGCAGCGGCACTAGCGGCACTGAACTGGCCATTCATCTTCCTCAAGCTCAGTACGTGGTCTAGGGAACTGCTCCAAACGACGAAATTATTGTTCATGAACTACGTGACCGTATGGCGCCGCATTATTACCAACAGACGTGTGAAACGATGCCGCCTCTTGAATTGTGTGTTTAACCAGCGGCGACGCATAGACTCGGGTCCACGGATGACACCTCCCAGCACATTTTGGCGGGCAAA

Full Affymetrix probeset data:

Annotations for 1633686_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720