FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633687_at:

>probe:Drosophila_2:1633687_at:35:591; Interrogation_Position=1016; Antisense; TGGTCACGAGTGTCGGATGTCCAGC
>probe:Drosophila_2:1633687_at:17:443; Interrogation_Position=1031; Antisense; GATGTCCAGCTTTTGCGGCTACGTG
>probe:Drosophila_2:1633687_at:49:141; Interrogation_Position=1051; Antisense; ACGTGCTGCACTTGCCGGAGGATCA
>probe:Drosophila_2:1633687_at:406:373; Interrogation_Position=1080; Antisense; GAAGTGCTGCAAGATGTCGTCGATC
>probe:Drosophila_2:1633687_at:147:589; Interrogation_Position=1144; Antisense; TGGAGTGCCAGTGCTTCACGGATGA
>probe:Drosophila_2:1633687_at:708:565; Interrogation_Position=1207; Antisense; GGCATCGGGTCATCTGGTCCAGTTC
>probe:Drosophila_2:1633687_at:318:615; Interrogation_Position=1300; Antisense; TGAATGCCGTCTTTGTGGTGCGACC
>probe:Drosophila_2:1633687_at:624:77; Interrogation_Position=1375; Antisense; AGGATGTTGTCTCCGCCGGCAGAAT
>probe:Drosophila_2:1633687_at:470:87; Interrogation_Position=1413; Antisense; AGTCGCCTCAATCTCTACAATGTCA
>probe:Drosophila_2:1633687_at:693:229; Interrogation_Position=1431; Antisense; AATGTCACCTTCTACAGCTTCTTTG
>probe:Drosophila_2:1633687_at:317:117; Interrogation_Position=1446; Antisense; AGCTTCTTTGTGATCGGACTCATCT
>probe:Drosophila_2:1633687_at:355:41; Interrogation_Position=1467; Antisense; ATCTGGCTGCTGAACCTGGGTTATG
>probe:Drosophila_2:1633687_at:296:511; Interrogation_Position=924; Antisense; GTGATCAGCCAGTTTCAGTTGCGAT
>probe:Drosophila_2:1633687_at:236:555; Interrogation_Position=964; Antisense; GGACGGATCTCGGTTACTCCGGCAA

Paste this into a BLAST search page for me
TGGTCACGAGTGTCGGATGTCCAGCGATGTCCAGCTTTTGCGGCTACGTGACGTGCTGCACTTGCCGGAGGATCAGAAGTGCTGCAAGATGTCGTCGATCTGGAGTGCCAGTGCTTCACGGATGAGGCATCGGGTCATCTGGTCCAGTTCTGAATGCCGTCTTTGTGGTGCGACCAGGATGTTGTCTCCGCCGGCAGAATAGTCGCCTCAATCTCTACAATGTCAAATGTCACCTTCTACAGCTTCTTTGAGCTTCTTTGTGATCGGACTCATCTATCTGGCTGCTGAACCTGGGTTATGGTGATCAGCCAGTTTCAGTTGCGATGGACGGATCTCGGTTACTCCGGCAA

Full Affymetrix probeset data:

Annotations for 1633687_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720