FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633690_at:

>probe:Drosophila_2:1633690_at:247:715; Interrogation_Position=1049; Antisense; TTCTGGGCCAACTACTTGCGCATTG
>probe:Drosophila_2:1633690_at:300:307; Interrogation_Position=1087; Antisense; CCTTGTGCTGCTATTCTTTGACGAG
>probe:Drosophila_2:1633690_at:705:533; Interrogation_Position=1114; Antisense; GGTCGCCGTACGCACAAAGTATAGT
>probe:Drosophila_2:1633690_at:473:243; Interrogation_Position=1263; Antisense; AATTTGATATGCAAGTGCCGCCGCA
>probe:Drosophila_2:1633690_at:407:507; Interrogation_Position=1277; Antisense; GTGCCGCCGCATACAATTTGTTTGT
>probe:Drosophila_2:1633690_at:116:343; Interrogation_Position=1332; Antisense; GCTTAATGTCCTAGTTCCAATCTCT
>probe:Drosophila_2:1633690_at:95:379; Interrogation_Position=1375; Antisense; GAACCAACTTGTGCCTTCATTAAGC
>probe:Drosophila_2:1633690_at:35:721; Interrogation_Position=1414; Antisense; TTCCTGTAGCCATTAACCGTGCAAT
>probe:Drosophila_2:1633690_at:127:333; Interrogation_Position=872; Antisense; GCTGGCTTGATAGCCGGATCCATTA
>probe:Drosophila_2:1633690_at:519:545; Interrogation_Position=887; Antisense; GGATCCATTATGTCGGTGGCCATAA
>probe:Drosophila_2:1633690_at:492:31; Interrogation_Position=908; Antisense; ATAACGCCGCCAGATGTAATCACCA
>probe:Drosophila_2:1633690_at:478:653; Interrogation_Position=924; Antisense; TAATCACCACGCGTCTGTACAATCA
>probe:Drosophila_2:1633690_at:384:225; Interrogation_Position=963; Antisense; AAGGACGCGGTCTTCTTTATCGCGG
>probe:Drosophila_2:1633690_at:261:541; Interrogation_Position=986; Antisense; GGTTGGCTTGACTGCTTTGTGAAAA

Paste this into a BLAST search page for me
TTCTGGGCCAACTACTTGCGCATTGCCTTGTGCTGCTATTCTTTGACGAGGGTCGCCGTACGCACAAAGTATAGTAATTTGATATGCAAGTGCCGCCGCAGTGCCGCCGCATACAATTTGTTTGTGCTTAATGTCCTAGTTCCAATCTCTGAACCAACTTGTGCCTTCATTAAGCTTCCTGTAGCCATTAACCGTGCAATGCTGGCTTGATAGCCGGATCCATTAGGATCCATTATGTCGGTGGCCATAAATAACGCCGCCAGATGTAATCACCATAATCACCACGCGTCTGTACAATCAAAGGACGCGGTCTTCTTTATCGCGGGGTTGGCTTGACTGCTTTGTGAAAA

Full Affymetrix probeset data:

Annotations for 1633690_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720