FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633691_at:

>probe:Drosophila_2:1633691_at:590:643; Interrogation_Position=480; Antisense; TCTTCACCACTACGTGTACAACTGG
>probe:Drosophila_2:1633691_at:202:657; Interrogation_Position=515; Antisense; TAATGCCGGCTCGTACGCTAAAGAA
>probe:Drosophila_2:1633691_at:210:375; Interrogation_Position=549; Antisense; GAAGATCCTGATTGACCAGCTGGTC
>probe:Drosophila_2:1633691_at:645:283; Interrogation_Position=585; Antisense; CTGCATCGTCATATTCTTCTATTCG
>probe:Drosophila_2:1633691_at:68:277; Interrogation_Position=600; Antisense; CTTCTATTCGCTTTGCTATCTGGAG
>probe:Drosophila_2:1633691_at:455:587; Interrogation_Position=635; Antisense; TGGACGCCACCAATCAGGAGCTGAT
>probe:Drosophila_2:1633691_at:545:605; Interrogation_Position=656; Antisense; TGATCTCCAAGTTCCCGTATGTTTA
>probe:Drosophila_2:1633691_at:675:349; Interrogation_Position=711; Antisense; GCAGTACCTGAACTTTCGCTATTTA
>probe:Drosophila_2:1633691_at:554:253; Interrogation_Position=741; Antisense; CAAATACCGGGTGACGTTCGTCAAT
>probe:Drosophila_2:1633691_at:106:653; Interrogation_Position=761; Antisense; TCAATGTGTGCACGGCTGTTTACAA
>probe:Drosophila_2:1633691_at:432:55; Interrogation_Position=802; Antisense; ATGAAGCACGATTTCGGCGTTCACC
>probe:Drosophila_2:1633691_at:38:391; Interrogation_Position=838; Antisense; GAGAAGTTAGTTGCGTCCTCCGAGC
>probe:Drosophila_2:1633691_at:106:421; Interrogation_Position=859; Antisense; GAGCAGAACCTATTGCCTCAGAGTT
>probe:Drosophila_2:1633691_at:334:135; Interrogation_Position=886; Antisense; ACGACGAGTCCCGATGCCCAAAAAG

Paste this into a BLAST search page for me
TCTTCACCACTACGTGTACAACTGGTAATGCCGGCTCGTACGCTAAAGAAGAAGATCCTGATTGACCAGCTGGTCCTGCATCGTCATATTCTTCTATTCGCTTCTATTCGCTTTGCTATCTGGAGTGGACGCCACCAATCAGGAGCTGATTGATCTCCAAGTTCCCGTATGTTTAGCAGTACCTGAACTTTCGCTATTTACAAATACCGGGTGACGTTCGTCAATTCAATGTGTGCACGGCTGTTTACAAATGAAGCACGATTTCGGCGTTCACCGAGAAGTTAGTTGCGTCCTCCGAGCGAGCAGAACCTATTGCCTCAGAGTTACGACGAGTCCCGATGCCCAAAAAG

Full Affymetrix probeset data:

Annotations for 1633691_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720