Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633692_at:

>probe:Drosophila_2:1633692_at:181:459; Interrogation_Position=1028; Antisense; GATATATGCTACCACCGACGCCGAA
>probe:Drosophila_2:1633692_at:6:43; Interrogation_Position=1063; Antisense; ATCGACAAGACGAGCACCTTCACTT
>probe:Drosophila_2:1633692_at:456:105; Interrogation_Position=1145; Antisense; AGAAACGTGGGTCGGTCATCCTCGA
>probe:Drosophila_2:1633692_at:452:711; Interrogation_Position=1218; Antisense; TTCAAGGAGCATGTCCTGCCACGAA
>probe:Drosophila_2:1633692_at:44:523; Interrogation_Position=1274; Antisense; GTGGCCCCAATTGCAGAACGAGCTG
>probe:Drosophila_2:1633692_at:623:381; Interrogation_Position=1289; Antisense; GAACGAGCTGCCTGTTTGCATGCTG
>probe:Drosophila_2:1633692_at:601:141; Interrogation_Position=1315; Antisense; ACGGCCATCGGCTGGCAGGTTAATT
>probe:Drosophila_2:1633692_at:66:129; Interrogation_Position=751; Antisense; ACCAACTCGTCGGTGGATCGTGGAT
>probe:Drosophila_2:1633692_at:310:447; Interrogation_Position=773; Antisense; GATGCGCACTCTTCGTTGGAGTCGA
>probe:Drosophila_2:1633692_at:432:495; Interrogation_Position=815; Antisense; GTCACATCAAGTACTGTTCCCTGCA
>probe:Drosophila_2:1633692_at:220:613; Interrogation_Position=843; Antisense; TGACAATTTCGCAGATGGCCTCCAA
>probe:Drosophila_2:1633692_at:386:111; Interrogation_Position=887; Antisense; AGAATCAGCAACTCGGCTCTGGACA
>probe:Drosophila_2:1633692_at:241:661; Interrogation_Position=920; Antisense; TAACTATGGCCTGTTGCGAGTGCGT
>probe:Drosophila_2:1633692_at:513:467; Interrogation_Position=968; Antisense; GTTCTGGACCCGATGGCGAGGACAA

Paste this into a BLAST search page for me
GATATATGCTACCACCGACGCCGAAATCGACAAGACGAGCACCTTCACTTAGAAACGTGGGTCGGTCATCCTCGATTCAAGGAGCATGTCCTGCCACGAAGTGGCCCCAATTGCAGAACGAGCTGGAACGAGCTGCCTGTTTGCATGCTGACGGCCATCGGCTGGCAGGTTAATTACCAACTCGTCGGTGGATCGTGGATGATGCGCACTCTTCGTTGGAGTCGAGTCACATCAAGTACTGTTCCCTGCATGACAATTTCGCAGATGGCCTCCAAAGAATCAGCAACTCGGCTCTGGACATAACTATGGCCTGTTGCGAGTGCGTGTTCTGGACCCGATGGCGAGGACAA

Full Affymetrix probeset data:

Annotations for 1633692_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime