FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633696_at:

>probe:Drosophila_2:1633696_at:82:289; Interrogation_Position=1011; Antisense; CTGGCCGTCGTATCGGAGCAGATCA
>probe:Drosophila_2:1633696_at:63:115; Interrogation_Position=1027; Antisense; AGCAGATCAGGAACCGCCTGCTGAT
>probe:Drosophila_2:1633696_at:579:627; Interrogation_Position=1067; Antisense; TGCCATCATAGCCATATTCCAGAGC
>probe:Drosophila_2:1633696_at:305:103; Interrogation_Position=1087; Antisense; AGAGCCTGGGAATCTTCTGTGCTGT
>probe:Drosophila_2:1633696_at:439:131; Interrogation_Position=1114; Antisense; ACCTGACCATTCTGTTCGGCAAGAA
>probe:Drosophila_2:1633696_at:1:399; Interrogation_Position=1140; Antisense; GACAACACCCATCCCATGAACATGA
>probe:Drosophila_2:1633696_at:648:91; Interrogation_Position=1186; Antisense; AGTTCTTGCCCCTGACCATACAGGA
>probe:Drosophila_2:1633696_at:185:559; Interrogation_Position=1208; Antisense; GGACAAGAGGCACGACATGCCCTCG
>probe:Drosophila_2:1633696_at:694:537; Interrogation_Position=1268; Antisense; GGTTTTAAAAACTGCTCTGCCCTCG
>probe:Drosophila_2:1633696_at:45:301; Interrogation_Position=1287; Antisense; CCCTCGGCCATGCACAAATGACAGA
>probe:Drosophila_2:1633696_at:379:285; Interrogation_Position=1401; Antisense; CTGTGACCCTCAATGTTACGTTATG
>probe:Drosophila_2:1633696_at:567:551; Interrogation_Position=962; Antisense; GGAGCACGCCTACGAGTCAGCATGT
>probe:Drosophila_2:1633696_at:714:671; Interrogation_Position=972; Antisense; TACGAGTCAGCATGTGATACCCACT
>probe:Drosophila_2:1633696_at:632:513; Interrogation_Position=985; Antisense; GTGATACCCACTACAAGCGCGGATG

Paste this into a BLAST search page for me
CTGGCCGTCGTATCGGAGCAGATCAAGCAGATCAGGAACCGCCTGCTGATTGCCATCATAGCCATATTCCAGAGCAGAGCCTGGGAATCTTCTGTGCTGTACCTGACCATTCTGTTCGGCAAGAAGACAACACCCATCCCATGAACATGAAGTTCTTGCCCCTGACCATACAGGAGGACAAGAGGCACGACATGCCCTCGGGTTTTAAAAACTGCTCTGCCCTCGCCCTCGGCCATGCACAAATGACAGACTGTGACCCTCAATGTTACGTTATGGGAGCACGCCTACGAGTCAGCATGTTACGAGTCAGCATGTGATACCCACTGTGATACCCACTACAAGCGCGGATG

Full Affymetrix probeset data:

Annotations for 1633696_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720