FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633698_at:

>probe:Drosophila_2:1633698_at:670:165; Interrogation_Position=329; Antisense; AAATGATCATCAAGCCATCCCGCTT
>probe:Drosophila_2:1633698_at:256:301; Interrogation_Position=347; Antisense; CCCGCTTCCAGTGGGACAAGTTCAA
>probe:Drosophila_2:1633698_at:353:223; Interrogation_Position=370; Antisense; AAGGATCTGTTGCACTTTTACGTAA
>probe:Drosophila_2:1633698_at:548:697; Interrogation_Position=385; Antisense; TTTTACGTAATGCTCGGCGTCATCC
>probe:Drosophila_2:1633698_at:341:133; Interrogation_Position=415; Antisense; ACCGCATTGGTTCTCTACGCGAACA
>probe:Drosophila_2:1633698_at:295:673; Interrogation_Position=430; Antisense; TACGCGAACATCTTTGTGGGACCCG
>probe:Drosophila_2:1633698_at:508:683; Interrogation_Position=528; Antisense; TATTTCCCGCTACATTTTGAACTCG
>probe:Drosophila_2:1633698_at:290:189; Interrogation_Position=562; Antisense; AACTACGAGAAATCCCTGCACTATC
>probe:Drosophila_2:1633698_at:255:183; Interrogation_Position=603; Antisense; AAAAGCCCAGATTCGACTCCTTGAG
>probe:Drosophila_2:1633698_at:94:555; Interrogation_Position=651; Antisense; GGAGCGCAATGATTACCAGGCCTAC
>probe:Drosophila_2:1633698_at:19:579; Interrogation_Position=693; Antisense; GGCCAAGTACCACAGGATTTCGAAA
>probe:Drosophila_2:1633698_at:728:301; Interrogation_Position=744; Antisense; GCGCGGAGACTAGAACCCTTGTAAT
>probe:Drosophila_2:1633698_at:260:21; Interrogation_Position=780; Antisense; ACCATTGTTAGGATCCCGTTTTGTG
>probe:Drosophila_2:1633698_at:202:237; Interrogation_Position=820; Antisense; AATCGACTTCGCAACATCATCTTAT

Paste this into a BLAST search page for me
AAATGATCATCAAGCCATCCCGCTTCCCGCTTCCAGTGGGACAAGTTCAAAAGGATCTGTTGCACTTTTACGTAATTTTACGTAATGCTCGGCGTCATCCACCGCATTGGTTCTCTACGCGAACATACGCGAACATCTTTGTGGGACCCGTATTTCCCGCTACATTTTGAACTCGAACTACGAGAAATCCCTGCACTATCAAAAGCCCAGATTCGACTCCTTGAGGGAGCGCAATGATTACCAGGCCTACGGCCAAGTACCACAGGATTTCGAAAGCGCGGAGACTAGAACCCTTGTAATACCATTGTTAGGATCCCGTTTTGTGAATCGACTTCGCAACATCATCTTAT

Full Affymetrix probeset data:

Annotations for 1633698_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720