FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633699_at:

>probe:Drosophila_2:1633699_at:343:651; Interrogation_Position=396; Antisense; TCACTACGTGCACCGCGACATTAAG
>probe:Drosophila_2:1633699_at:199:177; Interrogation_Position=425; Antisense; AAAACTTTCTGATGGGCGTTGGCCT
>probe:Drosophila_2:1633699_at:109:641; Interrogation_Position=479; Antisense; TCGGCCTATCCAAGCGGTACTGGGA
>probe:Drosophila_2:1633699_at:366:723; Interrogation_Position=588; Antisense; TTGTAAAGTGCAGTCCCGGCGGGAC
>probe:Drosophila_2:1633699_at:636:89; Interrogation_Position=614; Antisense; ACTTGGAATCGGTGGGCTACGTCCT
>probe:Drosophila_2:1633699_at:486:669; Interrogation_Position=631; Antisense; TACGTCCTCATTTACCTTTTGCGAG
>probe:Drosophila_2:1633699_at:355:701; Interrogation_Position=647; Antisense; TTTTGCGAGGTAGCCTGCCCTGGCA
>probe:Drosophila_2:1633699_at:273:395; Interrogation_Position=718; Antisense; GAAATGAAGCTGTCCACCTTGCCGA
>probe:Drosophila_2:1633699_at:570:27; Interrogation_Position=743; Antisense; ATAGCCTGTGTGCTGGATATCCAAA
>probe:Drosophila_2:1633699_at:284:29; Interrogation_Position=789; Antisense; ATACACCCGGCAACTGGGCTTCGAA
>probe:Drosophila_2:1633699_at:135:705; Interrogation_Position=825; Antisense; TTATCGGATGATTAGGTGCACCTTC
>probe:Drosophila_2:1633699_at:696:353; Interrogation_Position=842; Antisense; GCACCTTCTTGAGTTTGCTGTTTAA
>probe:Drosophila_2:1633699_at:711:373; Interrogation_Position=870; Antisense; GAAGTTCACCAATGATCTCATCTAC
>probe:Drosophila_2:1633699_at:182:669; Interrogation_Position=892; Antisense; TACGACTGGGACCACGCCGAGAAGA

Paste this into a BLAST search page for me
TCACTACGTGCACCGCGACATTAAGAAAACTTTCTGATGGGCGTTGGCCTTCGGCCTATCCAAGCGGTACTGGGATTGTAAAGTGCAGTCCCGGCGGGACACTTGGAATCGGTGGGCTACGTCCTTACGTCCTCATTTACCTTTTGCGAGTTTTGCGAGGTAGCCTGCCCTGGCAGAAATGAAGCTGTCCACCTTGCCGAATAGCCTGTGTGCTGGATATCCAAAATACACCCGGCAACTGGGCTTCGAATTATCGGATGATTAGGTGCACCTTCGCACCTTCTTGAGTTTGCTGTTTAAGAAGTTCACCAATGATCTCATCTACTACGACTGGGACCACGCCGAGAAGA

Full Affymetrix probeset data:

Annotations for 1633699_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720