Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633700_at:

>probe:Drosophila_2:1633700_at:130:187; Interrogation_Position=1586; Antisense; AACAAGGCATCCTCAGAGACGTCCA
>probe:Drosophila_2:1633700_at:595:581; Interrogation_Position=1651; Antisense; TGGCGAGGAATCGACGGCGTCTAAT
>probe:Drosophila_2:1633700_at:412:407; Interrogation_Position=1663; Antisense; GACGGCGTCTAATACCAATAGCAAC
>probe:Drosophila_2:1633700_at:123:33; Interrogation_Position=1710; Antisense; ATAATGATGCCGGAGCGACAGCTAA
>probe:Drosophila_2:1633700_at:504:325; Interrogation_Position=1724; Antisense; GCGACAGCTAATGCCGGATCCGGTT
>probe:Drosophila_2:1633700_at:109:387; Interrogation_Position=1789; Antisense; GAACAACATTTGACGTGGCGGCCGC
>probe:Drosophila_2:1633700_at:506:291; Interrogation_Position=1802; Antisense; CGTGGCGGCCGCAATTGGTTATAGA
>probe:Drosophila_2:1633700_at:162:109; Interrogation_Position=1824; Antisense; AGAAGCCAATTAAGCGACCGCCGAA
>probe:Drosophila_2:1633700_at:117:369; Interrogation_Position=1846; Antisense; GAAGTACAAGCCACCGGATTTCACC
>probe:Drosophila_2:1633700_at:703:541; Interrogation_Position=1861; Antisense; GGATTTCACCTAGTGTCGTCTCATT
>probe:Drosophila_2:1633700_at:516:269; Interrogation_Position=1919; Antisense; CATGTCCAGGGCTTTTTCTACACGC
>probe:Drosophila_2:1633700_at:510:663; Interrogation_Position=1947; Antisense; TACACAAGGTCCCACTGCGATCGGC
>probe:Drosophila_2:1633700_at:533:163; Interrogation_Position=2008; Antisense; AAATCAGTAATCAGTGGGCGGAAAC
>probe:Drosophila_2:1633700_at:415:149; Interrogation_Position=2084; Antisense; ACTTACAAGCGATCCAATGTGGCGA

Paste this into a BLAST search page for me
AACAAGGCATCCTCAGAGACGTCCATGGCGAGGAATCGACGGCGTCTAATGACGGCGTCTAATACCAATAGCAACATAATGATGCCGGAGCGACAGCTAAGCGACAGCTAATGCCGGATCCGGTTGAACAACATTTGACGTGGCGGCCGCCGTGGCGGCCGCAATTGGTTATAGAAGAAGCCAATTAAGCGACCGCCGAAGAAGTACAAGCCACCGGATTTCACCGGATTTCACCTAGTGTCGTCTCATTCATGTCCAGGGCTTTTTCTACACGCTACACAAGGTCCCACTGCGATCGGCAAATCAGTAATCAGTGGGCGGAAACACTTACAAGCGATCCAATGTGGCGA

Full Affymetrix probeset data:

Annotations for 1633700_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime