FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633701_at:

>probe:Drosophila_2:1633701_at:483:209; Interrogation_Position=101; Antisense; AAGCAGATGTCCGAGTACGCCAGCG
>probe:Drosophila_2:1633701_at:105:489; Interrogation_Position=115; Antisense; GTACGCCAGCGGGTCCAATGGATTC
>probe:Drosophila_2:1633701_at:360:251; Interrogation_Position=130; Antisense; CAATGGATTCGACCGCGTCTTGAAA
>probe:Drosophila_2:1633701_at:518:473; Interrogation_Position=199; Antisense; GTTCACTGTGGCCAATGAGCATTTG
>probe:Drosophila_2:1633701_at:681:367; Interrogation_Position=223; Antisense; GAATCGCCAAGGAACTTTGCACGGT
>probe:Drosophila_2:1633701_at:467:353; Interrogation_Position=241; Antisense; GCACGGTGGTCTTACGGCAACAATT
>probe:Drosophila_2:1633701_at:571:453; Interrogation_Position=269; Antisense; GATAATTGTACCACATATGCCCTTA
>probe:Drosophila_2:1633701_at:45:683; Interrogation_Position=292; Antisense; TATGTCGAAAGGATCCCATCCCGGA
>probe:Drosophila_2:1633701_at:120:289; Interrogation_Position=313; Antisense; CGGAGTTACGGCCAACCTGAATGTA
>probe:Drosophila_2:1633701_at:489:323; Interrogation_Position=353; Antisense; GCGAAACCTGGCGAACTTATTGAAA
>probe:Drosophila_2:1633701_at:5:7; Interrogation_Position=377; Antisense; ATTGATTGTAATACCGTGCGGGCCG
>probe:Drosophila_2:1633701_at:70:581; Interrogation_Position=411; Antisense; TGGCCTATTTGGACTGCATTCTGAG
>probe:Drosophila_2:1633701_at:618:143; Interrogation_Position=423; Antisense; ACTGCATTCTGAGGCGTAAGTCCGA
>probe:Drosophila_2:1633701_at:115:185; Interrogation_Position=550; Antisense; AAAATCTTTCGAACCTCTGCTTAAG

Paste this into a BLAST search page for me
AAGCAGATGTCCGAGTACGCCAGCGGTACGCCAGCGGGTCCAATGGATTCCAATGGATTCGACCGCGTCTTGAAAGTTCACTGTGGCCAATGAGCATTTGGAATCGCCAAGGAACTTTGCACGGTGCACGGTGGTCTTACGGCAACAATTGATAATTGTACCACATATGCCCTTATATGTCGAAAGGATCCCATCCCGGACGGAGTTACGGCCAACCTGAATGTAGCGAAACCTGGCGAACTTATTGAAAATTGATTGTAATACCGTGCGGGCCGTGGCCTATTTGGACTGCATTCTGAGACTGCATTCTGAGGCGTAAGTCCGAAAAATCTTTCGAACCTCTGCTTAAG

Full Affymetrix probeset data:

Annotations for 1633701_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720