FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633702_at:

>probe:Drosophila_2:1633702_at:252:195; Interrogation_Position=103; Antisense; AACTGCGAGACCAGATTCCAGCTGA
>probe:Drosophila_2:1633702_at:174:9; Interrogation_Position=117; Antisense; ATTCCAGCTGAGGATGCGCGAGAAC
>probe:Drosophila_2:1633702_at:462:67; Interrogation_Position=142; Antisense; AGGCGAGTCCTGTACAACTTTGATT
>probe:Drosophila_2:1633702_at:189:223; Interrogation_Position=169; Antisense; AAGGTGGACTCCTGCAAGTTCATGC
>probe:Drosophila_2:1633702_at:53:361; Interrogation_Position=200; Antisense; GCAAGCACGTGATCGCCAACTGGGT
>probe:Drosophila_2:1633702_at:724:429; Interrogation_Position=22; Antisense; GAGTACTGTTACTTGAAGTCCGTGA
>probe:Drosophila_2:1633702_at:191:137; Interrogation_Position=278; Antisense; ACGACATCGTGCTCGACAAGCTTCC
>probe:Drosophila_2:1633702_at:199:161; Interrogation_Position=293; Antisense; ACAAGCTTCCCGTGCAGCATCTGAA
>probe:Drosophila_2:1633702_at:572:345; Interrogation_Position=309; Antisense; GCATCTGAACAAGCTGGTCCAGTCG
>probe:Drosophila_2:1633702_at:638:369; Interrogation_Position=36; Antisense; GAAGTCCGTGAACCGCACCTACAAG
>probe:Drosophila_2:1633702_at:298:113; Interrogation_Position=364; Antisense; AGCACATGGATGGTCGCGGGCATTC
>probe:Drosophila_2:1633702_at:13:443; Interrogation_Position=397; Antisense; GATGTCATCCTATACTTTACCAAGA
>probe:Drosophila_2:1633702_at:730:353; Interrogation_Position=50; Antisense; GCACCTACAAGTACCTTTCGCTAAA
>probe:Drosophila_2:1633702_at:499:181; Interrogation_Position=73; Antisense; AAAACAAAGATGTTCCGCCTGCCCG

Paste this into a BLAST search page for me
AACTGCGAGACCAGATTCCAGCTGAATTCCAGCTGAGGATGCGCGAGAACAGGCGAGTCCTGTACAACTTTGATTAAGGTGGACTCCTGCAAGTTCATGCGCAAGCACGTGATCGCCAACTGGGTGAGTACTGTTACTTGAAGTCCGTGAACGACATCGTGCTCGACAAGCTTCCACAAGCTTCCCGTGCAGCATCTGAAGCATCTGAACAAGCTGGTCCAGTCGGAAGTCCGTGAACCGCACCTACAAGAGCACATGGATGGTCGCGGGCATTCGATGTCATCCTATACTTTACCAAGAGCACCTACAAGTACCTTTCGCTAAAAAAACAAAGATGTTCCGCCTGCCCG

Full Affymetrix probeset data:

Annotations for 1633702_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720