Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633703_s_at:

>probe:Drosophila_2:1633703_s_at:303:475; Interrogation_Position=1021; Antisense; GTTACTGTATCACAAGCGCCCTTCT
>probe:Drosophila_2:1633703_s_at:502:159; Interrogation_Position=1032; Antisense; ACAAGCGCCCTTCTGGAATATAACC
>probe:Drosophila_2:1633703_s_at:191:395; Interrogation_Position=535; Antisense; GAAATGTCGCATCTGGTTCACCTGA
>probe:Drosophila_2:1633703_s_at:552:609; Interrogation_Position=557; Antisense; TGACCGTCCTGCTCCTAGTGGGCAT
>probe:Drosophila_2:1633703_s_at:109:125; Interrogation_Position=601; Antisense; AGCGCCAAGCCGCACGAGGAGATCA
>probe:Drosophila_2:1633703_s_at:532:75; Interrogation_Position=617; Antisense; AGGAGATCAACAGGGACCACGCCGC
>probe:Drosophila_2:1633703_s_at:92:553; Interrogation_Position=693; Antisense; GGAGCAGCTGATGAGCCACGACCTG
>probe:Drosophila_2:1633703_s_at:210:281; Interrogation_Position=715; Antisense; CTGCCCGAGAGACACGAGGCCAAGT
>probe:Drosophila_2:1633703_s_at:267:73; Interrogation_Position=800; Antisense; AGGAACACGCCATCGAGTTGGTCAA
>probe:Drosophila_2:1633703_s_at:316:349; Interrogation_Position=844; Antisense; GCAGAGAAGGAAGACGCTCCCGCCG
>probe:Drosophila_2:1633703_s_at:132:221; Interrogation_Position=880; Antisense; AAGTGCGAGGCCATCGAGACACCCG
>probe:Drosophila_2:1633703_s_at:503:423; Interrogation_Position=895; Antisense; GAGACACCCGAGGATCATTGCGACG
>probe:Drosophila_2:1633703_s_at:660:627; Interrogation_Position=921; Antisense; TGCCTTCGCCTACGAGGAATGCATT
>probe:Drosophila_2:1633703_s_at:458:153; Interrogation_Position=993; Antisense; ACAGATTTGAGACCCATGACGACCC

Paste this into a BLAST search page for me
GTTACTGTATCACAAGCGCCCTTCTACAAGCGCCCTTCTGGAATATAACCGAAATGTCGCATCTGGTTCACCTGATGACCGTCCTGCTCCTAGTGGGCATAGCGCCAAGCCGCACGAGGAGATCAAGGAGATCAACAGGGACCACGCCGCGGAGCAGCTGATGAGCCACGACCTGCTGCCCGAGAGACACGAGGCCAAGTAGGAACACGCCATCGAGTTGGTCAAGCAGAGAAGGAAGACGCTCCCGCCGAAGTGCGAGGCCATCGAGACACCCGGAGACACCCGAGGATCATTGCGACGTGCCTTCGCCTACGAGGAATGCATTACAGATTTGAGACCCATGACGACCC

Full Affymetrix probeset data:

Annotations for 1633703_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime