Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633704_at:

>probe:Drosophila_2:1633704_at:401:719; Interrogation_Position=170; Antisense; TTCCACCGGGCGGAAGCACATAAAA
>probe:Drosophila_2:1633704_at:399:377; Interrogation_Position=182; Antisense; GAAGCACATAAAAGCGGAGCATCCC
>probe:Drosophila_2:1633704_at:243:125; Interrogation_Position=29; Antisense; AGCCCAAATCGAAGCATTTCTTACA
>probe:Drosophila_2:1633704_at:694:519; Interrogation_Position=335; Antisense; GTGGAATTTCCCCAAGGAGCACCGC
>probe:Drosophila_2:1633704_at:355:553; Interrogation_Position=350; Antisense; GGAGCACCGCTTTTCGGACACGCAA
>probe:Drosophila_2:1633704_at:438:559; Interrogation_Position=365; Antisense; GGACACGCAATGTATTTGTTCCTCA
>probe:Drosophila_2:1633704_at:6:471; Interrogation_Position=382; Antisense; GTTCCTCAAATACTAACCAATGCCC
>probe:Drosophila_2:1633704_at:284:377; Interrogation_Position=39; Antisense; GAAGCATTTCTTACATCTACAACAA
>probe:Drosophila_2:1633704_at:410:729; Interrogation_Position=415; Antisense; TTGTGTACGACACCATGGATGACTC
>probe:Drosophila_2:1633704_at:348:65; Interrogation_Position=429; Antisense; ATGGATGACTCGATGACTCCGATCT
>probe:Drosophila_2:1633704_at:393:637; Interrogation_Position=438; Antisense; TCGATGACTCCGATCTGCAGGAAGT
>probe:Drosophila_2:1633704_at:723:507; Interrogation_Position=461; Antisense; GTGCTTATCAAAGACCAGGTGCCTT
>probe:Drosophila_2:1633704_at:620:77; Interrogation_Position=477; Antisense; AGGTGCCTTCACTAAGCGTTTACTA
>probe:Drosophila_2:1633704_at:337:277; Interrogation_Position=488; Antisense; CTAAGCGTTTACTACATTTGTTAAT

Paste this into a BLAST search page for me
TTCCACCGGGCGGAAGCACATAAAAGAAGCACATAAAAGCGGAGCATCCCAGCCCAAATCGAAGCATTTCTTACAGTGGAATTTCCCCAAGGAGCACCGCGGAGCACCGCTTTTCGGACACGCAAGGACACGCAATGTATTTGTTCCTCAGTTCCTCAAATACTAACCAATGCCCGAAGCATTTCTTACATCTACAACAATTGTGTACGACACCATGGATGACTCATGGATGACTCGATGACTCCGATCTTCGATGACTCCGATCTGCAGGAAGTGTGCTTATCAAAGACCAGGTGCCTTAGGTGCCTTCACTAAGCGTTTACTACTAAGCGTTTACTACATTTGTTAAT

Full Affymetrix probeset data:

Annotations for 1633704_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime