FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633706_at:

>probe:Drosophila_2:1633706_at:164:231; Interrogation_Position=410; Antisense; AATGTGACCTGTGTGCCCATCTCCA
>probe:Drosophila_2:1633706_at:715:581; Interrogation_Position=547; Antisense; TGGCGAGTCTACCACCGTCACGGTG
>probe:Drosophila_2:1633706_at:705:531; Interrogation_Position=568; Antisense; GGTGCCCGTACCACCAACTGAAGCT
>probe:Drosophila_2:1633706_at:517:195; Interrogation_Position=583; Antisense; AACTGAAGCTCCTGGCAGCACCACG
>probe:Drosophila_2:1633706_at:7:577; Interrogation_Position=607; Antisense; GGCCTCCGGCAGTGACGACATCATT
>probe:Drosophila_2:1633706_at:428:611; Interrogation_Position=619; Antisense; TGACGACATCATTACCCCGACTGGT
>probe:Drosophila_2:1633706_at:333:511; Interrogation_Position=678; Antisense; GTGACAGCAACGTGCCCACTCCGGT
>probe:Drosophila_2:1633706_at:64:155; Interrogation_Position=716; Antisense; ACAGCTCCTGTCATCAACGACGGTC
>probe:Drosophila_2:1633706_at:165:573; Interrogation_Position=757; Antisense; GGCTGCCACCAAATAAGTCCTCGAG
>probe:Drosophila_2:1633706_at:63:659; Interrogation_Position=770; Antisense; TAAGTCCTCGAGTTGATTCTATCCA
>probe:Drosophila_2:1633706_at:373:419; Interrogation_Position=779; Antisense; GAGTTGATTCTATCCAAAACCCCAG
>probe:Drosophila_2:1633706_at:317:183; Interrogation_Position=794; Antisense; AAAACCCCAGATTTTGTGGCTGAAT
>probe:Drosophila_2:1633706_at:516:365; Interrogation_Position=815; Antisense; GAATAAAGTGTTGGCGCACACACAC
>probe:Drosophila_2:1633706_at:623:401; Interrogation_Position=943; Antisense; GACATATATAACTGTTTTTTGCCAA

Paste this into a BLAST search page for me
AATGTGACCTGTGTGCCCATCTCCATGGCGAGTCTACCACCGTCACGGTGGGTGCCCGTACCACCAACTGAAGCTAACTGAAGCTCCTGGCAGCACCACGGGCCTCCGGCAGTGACGACATCATTTGACGACATCATTACCCCGACTGGTGTGACAGCAACGTGCCCACTCCGGTACAGCTCCTGTCATCAACGACGGTCGGCTGCCACCAAATAAGTCCTCGAGTAAGTCCTCGAGTTGATTCTATCCAGAGTTGATTCTATCCAAAACCCCAGAAAACCCCAGATTTTGTGGCTGAATGAATAAAGTGTTGGCGCACACACACGACATATATAACTGTTTTTTGCCAA

Full Affymetrix probeset data:

Annotations for 1633706_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720