Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633707_at:

>probe:Drosophila_2:1633707_at:156:705; Interrogation_Position=111; Antisense; TTATCAGCAGCGCAGTACTCATCGG
>probe:Drosophila_2:1633707_at:502:669; Interrogation_Position=126; Antisense; TACTCATCGGCGGAGCCATCAAGGT
>probe:Drosophila_2:1633707_at:471:33; Interrogation_Position=143; Antisense; ATCAAGGTCGGCCATACTCCCAATG
>probe:Drosophila_2:1633707_at:248:253; Interrogation_Position=213; Antisense; CAAGCTCTTCGTGCCCTGGATGATC
>probe:Drosophila_2:1633707_at:477:589; Interrogation_Position=229; Antisense; TGGATGATCACAACCGCCATGTTCC
>probe:Drosophila_2:1633707_at:231:469; Interrogation_Position=249; Antisense; GTTCCTCTACTTAATGGGTTACTCA
>probe:Drosophila_2:1633707_at:183:531; Interrogation_Position=264; Antisense; GGGTTACTCATCCATTGTGCTGCTG
>probe:Drosophila_2:1633707_at:14:251; Interrogation_Position=30; Antisense; CAAGGCGGGCATTATTTGCTCCGGG
>probe:Drosophila_2:1633707_at:679:655; Interrogation_Position=305; Antisense; TAATCGTCATGTTTTGCGCAGCGCC
>probe:Drosophila_2:1633707_at:148:71; Interrogation_Position=336; Antisense; AGGCTGCCTCGGAATGGCATTCTAT
>probe:Drosophila_2:1633707_at:352:345; Interrogation_Position=352; Antisense; GCATTCTATGCGGTGCAGAAGGCCT
>probe:Drosophila_2:1633707_at:315:51; Interrogation_Position=385; Antisense; ATGCGCAAGGATGGGCTTCCACCGA
>probe:Drosophila_2:1633707_at:717:719; Interrogation_Position=401; Antisense; TTCCACCGAAGTATGCCGACATGCA
>probe:Drosophila_2:1633707_at:485:673; Interrogation_Position=82; Antisense; TACCTCATCATATTCGCCAACTTGA

Paste this into a BLAST search page for me
TTATCAGCAGCGCAGTACTCATCGGTACTCATCGGCGGAGCCATCAAGGTATCAAGGTCGGCCATACTCCCAATGCAAGCTCTTCGTGCCCTGGATGATCTGGATGATCACAACCGCCATGTTCCGTTCCTCTACTTAATGGGTTACTCAGGGTTACTCATCCATTGTGCTGCTGCAAGGCGGGCATTATTTGCTCCGGGTAATCGTCATGTTTTGCGCAGCGCCAGGCTGCCTCGGAATGGCATTCTATGCATTCTATGCGGTGCAGAAGGCCTATGCGCAAGGATGGGCTTCCACCGATTCCACCGAAGTATGCCGACATGCATACCTCATCATATTCGCCAACTTGA

Full Affymetrix probeset data:

Annotations for 1633707_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime