FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633708_at:

>probe:Drosophila_2:1633708_at:212:309; Interrogation_Position=1024; Antisense; GCCAATCGCAGCATGTGGTTTGCCA
>probe:Drosophila_2:1633708_at:459:509; Interrogation_Position=1078; Antisense; GTGCTACTGCAATTTCACCTAGTTA
>probe:Drosophila_2:1633708_at:266:167; Interrogation_Position=539; Antisense; AAATGGTGCCCATGGGCTACTTTCT
>probe:Drosophila_2:1633708_at:197:595; Interrogation_Position=569; Antisense; TGTGGCACATTGCTCGTGGCTTCGA
>probe:Drosophila_2:1633708_at:526:521; Interrogation_Position=584; Antisense; GTGGCTTCGATTGCGTCAACAGGCG
>probe:Drosophila_2:1633708_at:392:649; Interrogation_Position=599; Antisense; TCAACAGGCGTCTGGACCAAATTGT
>probe:Drosophila_2:1633708_at:4:83; Interrogation_Position=649; Antisense; AGGGAGCTGCAACATCTCTGGCTAC
>probe:Drosophila_2:1633708_at:232:95; Interrogation_Position=728; Antisense; AGATGTTGGCCTCCCGGTTCGATAA
>probe:Drosophila_2:1633708_at:692:491; Interrogation_Position=757; Antisense; GTAAACGGTGTAATCCAGGCCTATT
>probe:Drosophila_2:1633708_at:215:83; Interrogation_Position=838; Antisense; AGTGTCCAATACCACGTGCGCTGCT
>probe:Drosophila_2:1633708_at:391:283; Interrogation_Position=858; Antisense; CTGCTTGGACTACTATCTCATCGAT
>probe:Drosophila_2:1633708_at:679:549; Interrogation_Position=903; Antisense; GGAGTACCACGATTCAGCCAAGCAC
>probe:Drosophila_2:1633708_at:90:207; Interrogation_Position=960; Antisense; AAGCTCCTATGTGATCTATGCGAAT
>probe:Drosophila_2:1633708_at:702:5; Interrogation_Position=998; Antisense; AACTCTGGAGTTGTGGGCTTTTTCA

Paste this into a BLAST search page for me
GCCAATCGCAGCATGTGGTTTGCCAGTGCTACTGCAATTTCACCTAGTTAAAATGGTGCCCATGGGCTACTTTCTTGTGGCACATTGCTCGTGGCTTCGAGTGGCTTCGATTGCGTCAACAGGCGTCAACAGGCGTCTGGACCAAATTGTAGGGAGCTGCAACATCTCTGGCTACAGATGTTGGCCTCCCGGTTCGATAAGTAAACGGTGTAATCCAGGCCTATTAGTGTCCAATACCACGTGCGCTGCTCTGCTTGGACTACTATCTCATCGATGGAGTACCACGATTCAGCCAAGCACAAGCTCCTATGTGATCTATGCGAATAACTCTGGAGTTGTGGGCTTTTTCA

Full Affymetrix probeset data:

Annotations for 1633708_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720