FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633709_at:

>probe:Drosophila_2:1633709_at:178:175; Interrogation_Position=1019; Antisense; AAACCTGGAATACTACGGCGTGTCA
>probe:Drosophila_2:1633709_at:686:281; Interrogation_Position=1048; Antisense; CTCCGGCATATGATCTCACCAAGAT
>probe:Drosophila_2:1633709_at:436:97; Interrogation_Position=1069; Antisense; AGATCACCTCCGAGCTGTACTTATA
>probe:Drosophila_2:1633709_at:708:489; Interrogation_Position=1085; Antisense; GTACTTATACTATGGCTTGGCTGAT
>probe:Drosophila_2:1633709_at:423:247; Interrogation_Position=1157; Antisense; CAATTTGGCACTGCTTCACGAGGTG
>probe:Drosophila_2:1633709_at:262:537; Interrogation_Position=1197; Antisense; GGTCACTTGGACTTTATCTTCGCCA
>probe:Drosophila_2:1633709_at:540:663; Interrogation_Position=1265; Antisense; TAAAGCCTACGATGCGCGAGAAACT
>probe:Drosophila_2:1633709_at:106:693; Interrogation_Position=726; Antisense; TTTGGTCACCATGGCATTGGCTCCA
>probe:Drosophila_2:1633709_at:111:389; Interrogation_Position=759; Antisense; GAAAACCAGGTTTTGCTGCCCCAGA
>probe:Drosophila_2:1633709_at:16:109; Interrogation_Position=781; Antisense; AGAACGCGTTCATCCAGCGAGTACT
>probe:Drosophila_2:1633709_at:368:89; Interrogation_Position=800; Antisense; AGTACTGGACACCACATGCAGCAAT
>probe:Drosophila_2:1633709_at:285:645; Interrogation_Position=838; Antisense; TCAGCTACTGCAAAACCTTGGCCAT
>probe:Drosophila_2:1633709_at:620:237; Interrogation_Position=881; Antisense; AATCGGCAACCTTAACCAGACTCTG
>probe:Drosophila_2:1633709_at:272:175; Interrogation_Position=947; Antisense; AAACCAGGCCATTCACTACATTCAG

Paste this into a BLAST search page for me
AAACCTGGAATACTACGGCGTGTCACTCCGGCATATGATCTCACCAAGATAGATCACCTCCGAGCTGTACTTATAGTACTTATACTATGGCTTGGCTGATCAATTTGGCACTGCTTCACGAGGTGGGTCACTTGGACTTTATCTTCGCCATAAAGCCTACGATGCGCGAGAAACTTTTGGTCACCATGGCATTGGCTCCAGAAAACCAGGTTTTGCTGCCCCAGAAGAACGCGTTCATCCAGCGAGTACTAGTACTGGACACCACATGCAGCAATTCAGCTACTGCAAAACCTTGGCCATAATCGGCAACCTTAACCAGACTCTGAAACCAGGCCATTCACTACATTCAG

Full Affymetrix probeset data:

Annotations for 1633709_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720