FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633710_at:

>probe:Drosophila_2:1633710_at:652:119; Interrogation_Position=1706; Antisense; AGCTGCACCAATTCGAGTCCTGGCA
>probe:Drosophila_2:1633710_at:511:369; Interrogation_Position=1740; Antisense; GAAGGACTTGGATCCCCACGAGCAG
>probe:Drosophila_2:1633710_at:581:419; Interrogation_Position=1759; Antisense; GAGCAGGTCTGCAACACGCCGAATG
>probe:Drosophila_2:1633710_at:464:77; Interrogation_Position=1814; Antisense; AGGATCGATTCTTCTACACTTGCAT
>probe:Drosophila_2:1633710_at:522:721; Interrogation_Position=1833; Antisense; TTGCATGGAGTGTCCTGCCCAGTAT
>probe:Drosophila_2:1633710_at:70:91; Interrogation_Position=1853; Antisense; AGTATCCCTGGATTCGCAACGAGTT
>probe:Drosophila_2:1633710_at:31:253; Interrogation_Position=1869; Antisense; CAACGAGTTCGGCTTGGACTAAGGT
>probe:Drosophila_2:1633710_at:247:555; Interrogation_Position=1884; Antisense; GGACTAAGGTGATAGCCCGCTTGAC
>probe:Drosophila_2:1633710_at:118:345; Interrogation_Position=1902; Antisense; GCTTGACACTATAGGGCTCTGCGCA
>probe:Drosophila_2:1633710_at:561:269; Interrogation_Position=2069; Antisense; CTGACCGTAAGCAAACCCGTAGATA
>probe:Drosophila_2:1633710_at:257:343; Interrogation_Position=2165; Antisense; GCTTAAACAATTTCGCGGGCTCATA
>probe:Drosophila_2:1633710_at:648:297; Interrogation_Position=2178; Antisense; CGCGGGCTCATAAACGTGGTACTTT
>probe:Drosophila_2:1633710_at:534:197; Interrogation_Position=2190; Antisense; AACGTGGTACTTTGCGGCCTGATTA
>probe:Drosophila_2:1633710_at:326:29; Interrogation_Position=2233; Antisense; ATACGTATGTATGTCTCCGCTAAAT

Paste this into a BLAST search page for me
AGCTGCACCAATTCGAGTCCTGGCAGAAGGACTTGGATCCCCACGAGCAGGAGCAGGTCTGCAACACGCCGAATGAGGATCGATTCTTCTACACTTGCATTTGCATGGAGTGTCCTGCCCAGTATAGTATCCCTGGATTCGCAACGAGTTCAACGAGTTCGGCTTGGACTAAGGTGGACTAAGGTGATAGCCCGCTTGACGCTTGACACTATAGGGCTCTGCGCACTGACCGTAAGCAAACCCGTAGATAGCTTAAACAATTTCGCGGGCTCATACGCGGGCTCATAAACGTGGTACTTTAACGTGGTACTTTGCGGCCTGATTAATACGTATGTATGTCTCCGCTAAAT

Full Affymetrix probeset data:

Annotations for 1633710_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720