FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633713_at:

>probe:Drosophila_2:1633713_at:268:573; Interrogation_Position=354; Antisense; GGCTGCCGCTCTGACTGATAAGGAT
>probe:Drosophila_2:1633713_at:186:247; Interrogation_Position=407; Antisense; AATTCGATCGCCAAAATGCCTTGCT
>probe:Drosophila_2:1633713_at:35:535; Interrogation_Position=435; Antisense; GGTGCATTGTGAACATCCCACGGAT
>probe:Drosophila_2:1633713_at:130:259; Interrogation_Position=453; Antisense; CACGGATCACTCTGCGCAAATAGTT
>probe:Drosophila_2:1633713_at:470:135; Interrogation_Position=470; Antisense; AAATAGTTACCGGTCCCATTGTGCA
>probe:Drosophila_2:1633713_at:338:729; Interrogation_Position=488; Antisense; TTGTGCACACCAATTCCCTGAAATA
>probe:Drosophila_2:1633713_at:563:235; Interrogation_Position=509; Antisense; AATACCGCGTTTTCAAAGATCTGTG
>probe:Drosophila_2:1633713_at:153:219; Interrogation_Position=544; Antisense; AAGTACGTGACTTCCGGCGATGCAT
>probe:Drosophila_2:1633713_at:115:273; Interrogation_Position=566; Antisense; CATTTGGAGCGGACTTTCTGGTTTA
>probe:Drosophila_2:1633713_at:77:135; Interrogation_Position=614; Antisense; ACGCCTCCCACATTGTAATTTTGCA
>probe:Drosophila_2:1633713_at:407:419; Interrogation_Position=640; Antisense; GAGCAACCTGTAATTAAGCCCCTGG
>probe:Drosophila_2:1633713_at:465:659; Interrogation_Position=654; Antisense; TAAGCCCCTGGAACTGATAGCAAAA
>probe:Drosophila_2:1633713_at:379:183; Interrogation_Position=703; Antisense; AAAAGCTGCGTTTTCGCCTACGAGA
>probe:Drosophila_2:1633713_at:431:197; Interrogation_Position=759; Antisense; AACGGTCGCATGGTGCAATCTTGGA

Paste this into a BLAST search page for me
GGCTGCCGCTCTGACTGATAAGGATAATTCGATCGCCAAAATGCCTTGCTGGTGCATTGTGAACATCCCACGGATCACGGATCACTCTGCGCAAATAGTTAAATAGTTACCGGTCCCATTGTGCATTGTGCACACCAATTCCCTGAAATAAATACCGCGTTTTCAAAGATCTGTGAAGTACGTGACTTCCGGCGATGCATCATTTGGAGCGGACTTTCTGGTTTAACGCCTCCCACATTGTAATTTTGCAGAGCAACCTGTAATTAAGCCCCTGGTAAGCCCCTGGAACTGATAGCAAAAAAAAGCTGCGTTTTCGCCTACGAGAAACGGTCGCATGGTGCAATCTTGGA

Full Affymetrix probeset data:

Annotations for 1633713_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720