FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633714_at:

>probe:Drosophila_2:1633714_at:614:135; Interrogation_Position=2924; Antisense; ACGAGGATGTCTTCTACTTGGGCGG
>probe:Drosophila_2:1633714_at:726:191; Interrogation_Position=2956; Antisense; AACTCGGACTCGGTGAGCAGGCGCA
>probe:Drosophila_2:1633714_at:157:325; Interrogation_Position=2976; Antisense; GCGCACAAAGGGTCGCTTCTTCGAT
>probe:Drosophila_2:1633714_at:95:221; Interrogation_Position=3007; Antisense; AAGGGCTGCCTGCAGGATATCCAGT
>probe:Drosophila_2:1633714_at:34:417; Interrogation_Position=3035; Antisense; GAGCCGAGCCCACAGCGATTATCAG
>probe:Drosophila_2:1633714_at:571:461; Interrogation_Position=3051; Antisense; GATTATCAGCGACTTCTCGACGTAC
>probe:Drosophila_2:1633714_at:694:523; Interrogation_Position=3078; Antisense; GGGCGAGAACATTGGATCCTGTGAT
>probe:Drosophila_2:1633714_at:477:449; Interrogation_Position=3092; Antisense; GATCCTGTGATCTGCACGGCGATGA
>probe:Drosophila_2:1633714_at:275:293; Interrogation_Position=3111; Antisense; CGATGAGCCGCTTACTGTATAGGAA
>probe:Drosophila_2:1633714_at:254:561; Interrogation_Position=3178; Antisense; GGAACACTTTGATCGATCTGGACTT
>probe:Drosophila_2:1633714_at:13:451; Interrogation_Position=3192; Antisense; GATCTGGACTTTCAGGACTCGCAAA
>probe:Drosophila_2:1633714_at:47:557; Interrogation_Position=3206; Antisense; GGACTCGCAAACTTCTTGGGAATCT
>probe:Drosophila_2:1633714_at:544:305; Interrogation_Position=3306; Antisense; CCTCCTTCGCCGGAATCAATATATA
>probe:Drosophila_2:1633714_at:6:31; Interrogation_Position=3328; Antisense; ATACACACAGTTTTTGGGCAAAGCT

Paste this into a BLAST search page for me
ACGAGGATGTCTTCTACTTGGGCGGAACTCGGACTCGGTGAGCAGGCGCAGCGCACAAAGGGTCGCTTCTTCGATAAGGGCTGCCTGCAGGATATCCAGTGAGCCGAGCCCACAGCGATTATCAGGATTATCAGCGACTTCTCGACGTACGGGCGAGAACATTGGATCCTGTGATGATCCTGTGATCTGCACGGCGATGACGATGAGCCGCTTACTGTATAGGAAGGAACACTTTGATCGATCTGGACTTGATCTGGACTTTCAGGACTCGCAAAGGACTCGCAAACTTCTTGGGAATCTCCTCCTTCGCCGGAATCAATATATAATACACACAGTTTTTGGGCAAAGCT

Full Affymetrix probeset data:

Annotations for 1633714_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720