FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633716_at:

>probe:Drosophila_2:1633716_at:544:317; Interrogation_Position=1009; Antisense; GCCGACTTCGTAAGCCTAAAGGGCG
>probe:Drosophila_2:1633716_at:616:269; Interrogation_Position=1024; Antisense; CTAAAGGGCGGACAGTTCTGCGATT
>probe:Drosophila_2:1633716_at:387:325; Interrogation_Position=1043; Antisense; GCGATTGGGTAGTTGATCTGAACAC
>probe:Drosophila_2:1633716_at:420:193; Interrogation_Position=1070; Antisense; AACTACTTGAGCAATTGGCTGGCGA
>probe:Drosophila_2:1633716_at:70:577; Interrogation_Position=1134; Antisense; GGCCCAAGGTTGAAGATTTCCACAA
>probe:Drosophila_2:1633716_at:686:157; Interrogation_Position=1173; Antisense; ACACATGGTTATTAGCCTGCGGTAC
>probe:Drosophila_2:1633716_at:394:675; Interrogation_Position=1185; Antisense; TAGCCTGCGGTACTTTTAATATTTT
>probe:Drosophila_2:1633716_at:264:311; Interrogation_Position=1302; Antisense; GCCAGAGCAAACTATTATGTCACTT
>probe:Drosophila_2:1633716_at:592:681; Interrogation_Position=1317; Antisense; TATGTCACTTACGTACAAGCATGAT
>probe:Drosophila_2:1633716_at:254:15; Interrogation_Position=1451; Antisense; ATATTTCCCAAAAGCCAGTTTCACT
>probe:Drosophila_2:1633716_at:506:313; Interrogation_Position=1464; Antisense; GCCAGTTTCACTTGAAGGTGCTATC
>probe:Drosophila_2:1633716_at:529:73; Interrogation_Position=950; Antisense; AGGAACAGATTCCAGGTCCCTTCGA
>probe:Drosophila_2:1633716_at:540:71; Interrogation_Position=963; Antisense; AGGTCCCTTCGAGCCAAAGGACGAG
>probe:Drosophila_2:1633716_at:486:483; Interrogation_Position=994; Antisense; GTAAACGTGTTCCTGGCCGACTTCG

Paste this into a BLAST search page for me
GCCGACTTCGTAAGCCTAAAGGGCGCTAAAGGGCGGACAGTTCTGCGATTGCGATTGGGTAGTTGATCTGAACACAACTACTTGAGCAATTGGCTGGCGAGGCCCAAGGTTGAAGATTTCCACAAACACATGGTTATTAGCCTGCGGTACTAGCCTGCGGTACTTTTAATATTTTGCCAGAGCAAACTATTATGTCACTTTATGTCACTTACGTACAAGCATGATATATTTCCCAAAAGCCAGTTTCACTGCCAGTTTCACTTGAAGGTGCTATCAGGAACAGATTCCAGGTCCCTTCGAAGGTCCCTTCGAGCCAAAGGACGAGGTAAACGTGTTCCTGGCCGACTTCG

Full Affymetrix probeset data:

Annotations for 1633716_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720