FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633718_at:

>probe:Drosophila_2:1633718_at:60:701; Interrogation_Position=1962; Antisense; TTTTGGTCGGCTCGTGTATCAACCA
>probe:Drosophila_2:1633718_at:298:481; Interrogation_Position=1977; Antisense; GTATCAACCAACGTCCGGATTTGTT
>probe:Drosophila_2:1633718_at:13:285; Interrogation_Position=2007; Antisense; CTGCTGTGGCTCAAGTTGGTGTCAT
>probe:Drosophila_2:1633718_at:486:681; Interrogation_Position=2035; Antisense; TATGTTGCGCTTCCACAAGTTCACC
>probe:Drosophila_2:1633718_at:472:217; Interrogation_Position=2051; Antisense; AAGTTCACCATTGGCCACGCTTGGT
>probe:Drosophila_2:1633718_at:231:261; Interrogation_Position=2066; Antisense; CACGCTTGGTGCTCGGATTATGGAA
>probe:Drosophila_2:1633718_at:209:723; Interrogation_Position=2112; Antisense; TTGACAACCTGTACAAGTTCTCGCC
>probe:Drosophila_2:1633718_at:276:217; Interrogation_Position=2126; Antisense; AAGTTCTCGCCGCTGCATAATGTGC
>probe:Drosophila_2:1633718_at:75:655; Interrogation_Position=2143; Antisense; TAATGTGCACACTCCGAAGGGCGCC
>probe:Drosophila_2:1633718_at:420:365; Interrogation_Position=2174; Antisense; GAATACCCATCGACTTTGATCCTGA
>probe:Drosophila_2:1633718_at:409:267; Interrogation_Position=2258; Antisense; CAGGAAGCTGTTCGCGACTCGGAAT
>probe:Drosophila_2:1633718_at:167:107; Interrogation_Position=2286; Antisense; AGAAAAATCCCGTTCTGTTGCGCGT
>probe:Drosophila_2:1633718_at:246:69; Interrogation_Position=2328; Antisense; ATGGCGCTGGCAAGCCGACATCGAA
>probe:Drosophila_2:1633718_at:297:127; Interrogation_Position=2365; Antisense; AGCCACCGATATACTGACTTTCTTG

Paste this into a BLAST search page for me
TTTTGGTCGGCTCGTGTATCAACCAGTATCAACCAACGTCCGGATTTGTTCTGCTGTGGCTCAAGTTGGTGTCATTATGTTGCGCTTCCACAAGTTCACCAAGTTCACCATTGGCCACGCTTGGTCACGCTTGGTGCTCGGATTATGGAATTGACAACCTGTACAAGTTCTCGCCAAGTTCTCGCCGCTGCATAATGTGCTAATGTGCACACTCCGAAGGGCGCCGAATACCCATCGACTTTGATCCTGACAGGAAGCTGTTCGCGACTCGGAATAGAAAAATCCCGTTCTGTTGCGCGTATGGCGCTGGCAAGCCGACATCGAAAGCCACCGATATACTGACTTTCTTG

Full Affymetrix probeset data:

Annotations for 1633718_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720