FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633719_at:

>probe:Drosophila_2:1633719_at:188:101; Interrogation_Position=1004; Antisense; AGAGCATTCACTATGGTAAGCCCAT
>probe:Drosophila_2:1633719_at:398:493; Interrogation_Position=1019; Antisense; GTAAGCCCATGCTGGGATTGCCCTT
>probe:Drosophila_2:1633719_at:561:275; Interrogation_Position=1041; Antisense; CTTCTTCTACGACCAATTTACCAAT
>probe:Drosophila_2:1633719_at:13:69; Interrogation_Position=1085; Antisense; ATGGCTTTTGCCTGTCTTTGAACTA
>probe:Drosophila_2:1633719_at:725:369; Interrogation_Position=1134; Antisense; GAAGGCCACAATACTCCAGTTGCTG
>probe:Drosophila_2:1633719_at:127:27; Interrogation_Position=1189; Antisense; ATAGCAGGTGCTCGCTATCGAGATC
>probe:Drosophila_2:1633719_at:42:425; Interrogation_Position=1231; Antisense; GAGACAGCTGTCTGGTGGACTCACT
>probe:Drosophila_2:1633719_at:357:107; Interrogation_Position=1300; Antisense; AGAAAATTGAGCTTCTTCACCCACC
>probe:Drosophila_2:1633719_at:329:89; Interrogation_Position=1327; Antisense; AGTCTGGATGTCTTGGGCACTGTTC
>probe:Drosophila_2:1633719_at:349:593; Interrogation_Position=1340; Antisense; TGGGCACTGTTCTTCTTGTTATTTT
>probe:Drosophila_2:1633719_at:238:343; Interrogation_Position=1365; Antisense; GCTTGTTATCATTGCCATTCTTCTT
>probe:Drosophila_2:1633719_at:508:213; Interrogation_Position=884; Antisense; AAGAGCTGCAGGATATACCGTCGAA
>probe:Drosophila_2:1633719_at:506:673; Interrogation_Position=899; Antisense; TACCGTCGAATGTTCTAGTACGCAA
>probe:Drosophila_2:1633719_at:606:589; Interrogation_Position=925; Antisense; TGGTTACCGCAACAGGACCTACTGG

Paste this into a BLAST search page for me
AGAGCATTCACTATGGTAAGCCCATGTAAGCCCATGCTGGGATTGCCCTTCTTCTTCTACGACCAATTTACCAATATGGCTTTTGCCTGTCTTTGAACTAGAAGGCCACAATACTCCAGTTGCTGATAGCAGGTGCTCGCTATCGAGATCGAGACAGCTGTCTGGTGGACTCACTAGAAAATTGAGCTTCTTCACCCACCAGTCTGGATGTCTTGGGCACTGTTCTGGGCACTGTTCTTCTTGTTATTTTGCTTGTTATCATTGCCATTCTTCTTAAGAGCTGCAGGATATACCGTCGAATACCGTCGAATGTTCTAGTACGCAATGGTTACCGCAACAGGACCTACTGG

Full Affymetrix probeset data:

Annotations for 1633719_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720