FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633721_at:

>probe:Drosophila_2:1633721_at:528:587; Interrogation_Position=1016; Antisense; TGGAGCGGCATGTGCATGGCACCAC
>probe:Drosophila_2:1633721_at:533:197; Interrogation_Position=1050; Antisense; AACGGAGTACTCCACGGCCATATCC
>probe:Drosophila_2:1633721_at:77:23; Interrogation_Position=1069; Antisense; ATATCCAGTGGCCAACTGCAACAGG
>probe:Drosophila_2:1633721_at:210:143; Interrogation_Position=1083; Antisense; ACTGCAACAGGCCTTTGCCGAATTG
>probe:Drosophila_2:1633721_at:690:65; Interrogation_Position=1091; Antisense; AGGCCTTTGCCGAATTGCAGCTCCA
>probe:Drosophila_2:1633721_at:50:723; Interrogation_Position=1105; Antisense; TTGCAGCTCCACTCGAGCAACAATA
>probe:Drosophila_2:1633721_at:99:351; Interrogation_Position=1146; Antisense; GCAGCAACATTTACTTTTAAGCAAC
>probe:Drosophila_2:1633721_at:700:361; Interrogation_Position=1181; Antisense; GCAATAATTCAATGGCAGCGGCACA
>probe:Drosophila_2:1633721_at:399:121; Interrogation_Position=1197; Antisense; AGCGGCACAGACAACGGCATCTCTG
>probe:Drosophila_2:1633721_at:704:397; Interrogation_Position=1206; Antisense; GACAACGGCATCTCTGATGAAGAAT
>probe:Drosophila_2:1633721_at:321:513; Interrogation_Position=1232; Antisense; GTGATCTACTGATATCGAACAATCT
>probe:Drosophila_2:1633721_at:384:387; Interrogation_Position=1248; Antisense; GAACAATCTGTATCCACCGAGAAGA
>probe:Drosophila_2:1633721_at:458:47; Interrogation_Position=1259; Antisense; ATCCACCGAGAAGAGAGTTACTAGA
>probe:Drosophila_2:1633721_at:119:447; Interrogation_Position=970; Antisense; GATGCAGCGCCACCATCGTCGTCAT

Paste this into a BLAST search page for me
TGGAGCGGCATGTGCATGGCACCACAACGGAGTACTCCACGGCCATATCCATATCCAGTGGCCAACTGCAACAGGACTGCAACAGGCCTTTGCCGAATTGAGGCCTTTGCCGAATTGCAGCTCCATTGCAGCTCCACTCGAGCAACAATAGCAGCAACATTTACTTTTAAGCAACGCAATAATTCAATGGCAGCGGCACAAGCGGCACAGACAACGGCATCTCTGGACAACGGCATCTCTGATGAAGAATGTGATCTACTGATATCGAACAATCTGAACAATCTGTATCCACCGAGAAGAATCCACCGAGAAGAGAGTTACTAGAGATGCAGCGCCACCATCGTCGTCAT

Full Affymetrix probeset data:

Annotations for 1633721_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720