FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633723_at:

>probe:Drosophila_2:1633723_at:571:141; Interrogation_Position=2125; Antisense; ACGGCGACGCGGATATTCACCAAAT
>probe:Drosophila_2:1633723_at:448:459; Interrogation_Position=2136; Antisense; GATATTCACCAAATCATGCTGACCA
>probe:Drosophila_2:1633723_at:158:379; Interrogation_Position=2167; Antisense; GAAGCGATCAATACGTGCATCACCG
>probe:Drosophila_2:1633723_at:135:509; Interrogation_Position=2181; Antisense; GTGCATCACCGTTCAAACCATGATA
>probe:Drosophila_2:1633723_at:413:475; Interrogation_Position=2239; Antisense; GTTACAAATTGCACCAACGATGTTG
>probe:Drosophila_2:1633723_at:417:395; Interrogation_Position=2266; Antisense; GAAATCAATTGGATGTTGCCTTTAA
>probe:Drosophila_2:1633723_at:681:523; Interrogation_Position=2300; Antisense; GGGATTCGAATTCATTTTACAGCCG
>probe:Drosophila_2:1633723_at:494:223; Interrogation_Position=2325; Antisense; AAGGTATTCGATGCAGGGTACTGCC
>probe:Drosophila_2:1633723_at:50:81; Interrogation_Position=2339; Antisense; AGGGTACTGCCACGGAAGATGTCCA
>probe:Drosophila_2:1633723_at:636:563; Interrogation_Position=2352; Antisense; GGAAGATGTCCACCACGTCACAATC
>probe:Drosophila_2:1633723_at:176:261; Interrogation_Position=2388; Antisense; CACGCCCTACTGCAAAGTCTGATAT
>probe:Drosophila_2:1633723_at:409:51; Interrogation_Position=2444; Antisense; ATGCTGTACTCCTTCAAAGCTTGAG
>probe:Drosophila_2:1633723_at:6:543; Interrogation_Position=2540; Antisense; GGTTGTAGAATGTGCCTGTTCGTAA
>probe:Drosophila_2:1633723_at:655:699; Interrogation_Position=2692; Antisense; TTTTTGTTCGTATAGCGGCATTTAC

Paste this into a BLAST search page for me
ACGGCGACGCGGATATTCACCAAATGATATTCACCAAATCATGCTGACCAGAAGCGATCAATACGTGCATCACCGGTGCATCACCGTTCAAACCATGATAGTTACAAATTGCACCAACGATGTTGGAAATCAATTGGATGTTGCCTTTAAGGGATTCGAATTCATTTTACAGCCGAAGGTATTCGATGCAGGGTACTGCCAGGGTACTGCCACGGAAGATGTCCAGGAAGATGTCCACCACGTCACAATCCACGCCCTACTGCAAAGTCTGATATATGCTGTACTCCTTCAAAGCTTGAGGGTTGTAGAATGTGCCTGTTCGTAATTTTTGTTCGTATAGCGGCATTTAC

Full Affymetrix probeset data:

Annotations for 1633723_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720