Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633724_at:

>probe:Drosophila_2:1633724_at:692:513; Interrogation_Position=1113; Antisense; GTGTAAAATTGTCATAAACCTTATT
>probe:Drosophila_2:1633724_at:306:173; Interrogation_Position=1128; Antisense; AAACCTTATTAGTGTCTATACGTAT
>probe:Drosophila_2:1633724_at:427:515; Interrogation_Position=1139; Antisense; GTGTCTATACGTATGAGCAAAACCA
>probe:Drosophila_2:1633724_at:638:607; Interrogation_Position=1152; Antisense; TGAGCAAAACCACAAGTATCGTACT
>probe:Drosophila_2:1633724_at:504:207; Interrogation_Position=1165; Antisense; AAGTATCGTACTCAACTAACAAATA
>probe:Drosophila_2:1633724_at:659:493; Interrogation_Position=1193; Antisense; GTCAAATTTTCTACTTCAACTACTT
>probe:Drosophila_2:1633724_at:239:641; Interrogation_Position=1202; Antisense; TCTACTTCAACTACTTCAACTACAT
>probe:Drosophila_2:1633724_at:594:651; Interrogation_Position=1217; Antisense; TCAACTACATTTCAACTACTTACAA
>probe:Drosophila_2:1633724_at:629:379; Interrogation_Position=1267; Antisense; GAACTACAATACAGAACCAACAACA
>probe:Drosophila_2:1633724_at:551:185; Interrogation_Position=1288; Antisense; AACAAAACAAAGATGCAACCGCAGC
>probe:Drosophila_2:1633724_at:593:359; Interrogation_Position=1302; Antisense; GCAACCGCAGCAACAAGAATAACAA
>probe:Drosophila_2:1633724_at:474:25; Interrogation_Position=1422; Antisense; ATAGAATACAAGAACCGCCGAACAG
>probe:Drosophila_2:1633724_at:644:379; Interrogation_Position=1433; Antisense; GAACCGCCGAACAGAATACATTTTA
>probe:Drosophila_2:1633724_at:435:689; Interrogation_Position=1575; Antisense; TATTATTTTAATTTTGGCATTGCAA

Paste this into a BLAST search page for me
GTGTAAAATTGTCATAAACCTTATTAAACCTTATTAGTGTCTATACGTATGTGTCTATACGTATGAGCAAAACCATGAGCAAAACCACAAGTATCGTACTAAGTATCGTACTCAACTAACAAATAGTCAAATTTTCTACTTCAACTACTTTCTACTTCAACTACTTCAACTACATTCAACTACATTTCAACTACTTACAAGAACTACAATACAGAACCAACAACAAACAAAACAAAGATGCAACCGCAGCGCAACCGCAGCAACAAGAATAACAAATAGAATACAAGAACCGCCGAACAGGAACCGCCGAACAGAATACATTTTATATTATTTTAATTTTGGCATTGCAA

Full Affymetrix probeset data:

Annotations for 1633724_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime