Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633726_s_at:

>probe:Drosophila_2:1633726_s_at:324:419; Interrogation_Position=112; Antisense; GAGCTGCGCCTGAAGCGATTCTGGC
>probe:Drosophila_2:1633726_s_at:133:505; Interrogation_Position=153; Antisense; GTCCTCGGAGGACTCCAATGGCTAT
>probe:Drosophila_2:1633726_s_at:620:571; Interrogation_Position=172; Antisense; GGCTATGAGAGTCCCACGAGAACGA
>probe:Drosophila_2:1633726_s_at:690:135; Interrogation_Position=187; Antisense; ACGAGAACGAAAGCGTCCAGTGCCG
>probe:Drosophila_2:1633726_s_at:101:113; Interrogation_Position=217; Antisense; AGCAGCGATGCCCAGAGATTCAACC
>probe:Drosophila_2:1633726_s_at:321:101; Interrogation_Position=230; Antisense; AGAGATTCAACCACCTGCACTACAC
>probe:Drosophila_2:1633726_s_at:273:667; Interrogation_Position=250; Antisense; TACACCAGCCTGTCGCAGGGATCGG
>probe:Drosophila_2:1633726_s_at:248:149; Interrogation_Position=369; Antisense; ACTTTTGCAGGTGTGGCCCAGCCAG
>probe:Drosophila_2:1633726_s_at:607:203; Interrogation_Position=410; Antisense; AAGCGGATGGCCAGTCCTTCGTGTT
>probe:Drosophila_2:1633726_s_at:14:513; Interrogation_Position=430; Antisense; GTGTTCCCGGCCATCGTGGAGACGA
>probe:Drosophila_2:1633726_s_at:278:105; Interrogation_Position=449; Antisense; AGACGAGTGTCAGCAGTCCGACAGC
>probe:Drosophila_2:1633726_s_at:388:529; Interrogation_Position=499; Antisense; GGGAGCACCAACCTGAGTCTGAACG
>probe:Drosophila_2:1633726_s_at:223:551; Interrogation_Position=566; Antisense; GGAGTTCTCTGTACTGTGATACCCT
>probe:Drosophila_2:1633726_s_at:571:405; Interrogation_Position=601; Antisense; GACTCCGGCATCGATTCGGTGCAGG

Paste this into a BLAST search page for me
GAGCTGCGCCTGAAGCGATTCTGGCGTCCTCGGAGGACTCCAATGGCTATGGCTATGAGAGTCCCACGAGAACGAACGAGAACGAAAGCGTCCAGTGCCGAGCAGCGATGCCCAGAGATTCAACCAGAGATTCAACCACCTGCACTACACTACACCAGCCTGTCGCAGGGATCGGACTTTTGCAGGTGTGGCCCAGCCAGAAGCGGATGGCCAGTCCTTCGTGTTGTGTTCCCGGCCATCGTGGAGACGAAGACGAGTGTCAGCAGTCCGACAGCGGGAGCACCAACCTGAGTCTGAACGGGAGTTCTCTGTACTGTGATACCCTGACTCCGGCATCGATTCGGTGCAGG

Full Affymetrix probeset data:

Annotations for 1633726_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime