Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633728_at:

>probe:Drosophila_2:1633728_at:116:719; Interrogation_Position=1011; Antisense; TTCCCAAGGATGGTCGGCCAAACTA
>probe:Drosophila_2:1633728_at:728:347; Interrogation_Position=1019; Antisense; GATGGTCGGCCAAACTAACCAAATT
>probe:Drosophila_2:1633728_at:536:445; Interrogation_Position=1177; Antisense; GATGCTTCTTCCAAAGATGAGAATA
>probe:Drosophila_2:1633728_at:300:447; Interrogation_Position=1219; Antisense; GATGCTCCGTCTAAAGATGAGGATA
>probe:Drosophila_2:1633728_at:441:435; Interrogation_Position=1258; Antisense; GAGGATGCTTCTTCTGAATATGAAG
>probe:Drosophila_2:1633728_at:629:567; Interrogation_Position=1296; Antisense; GGCATCGAACGCTTTCAATTTCGTC
>probe:Drosophila_2:1633728_at:401:661; Interrogation_Position=1340; Antisense; TAAAAGAGTTTTACGATGCCCCAAG
>probe:Drosophila_2:1633728_at:240:49; Interrogation_Position=1355; Antisense; ATGCCCCAAGGGAACTCATCCAAGA
>probe:Drosophila_2:1633728_at:465:189; Interrogation_Position=1367; Antisense; AACTCATCCAAGAACCCAAAGTCGG
>probe:Drosophila_2:1633728_at:305:289; Interrogation_Position=1389; Antisense; CGGAAAGTCCGATCAGAATTGGGAT
>probe:Drosophila_2:1633728_at:398:17; Interrogation_Position=1412; Antisense; ATTTAATTCTTCGAACTGTGCTGGA
>probe:Drosophila_2:1633728_at:196:623; Interrogation_Position=1430; Antisense; TGCTGGAAGATATCAAAGCCGTACT
>probe:Drosophila_2:1633728_at:206:461; Interrogation_Position=1455; Antisense; GATTTACTCAACTGAACGCATCGAA
>probe:Drosophila_2:1633728_at:666:121; Interrogation_Position=1482; Antisense; AGCGATCCAGAGCTATATCAATAAG

Paste this into a BLAST search page for me
TTCCCAAGGATGGTCGGCCAAACTAGATGGTCGGCCAAACTAACCAAATTGATGCTTCTTCCAAAGATGAGAATAGATGCTCCGTCTAAAGATGAGGATAGAGGATGCTTCTTCTGAATATGAAGGGCATCGAACGCTTTCAATTTCGTCTAAAAGAGTTTTACGATGCCCCAAGATGCCCCAAGGGAACTCATCCAAGAAACTCATCCAAGAACCCAAAGTCGGCGGAAAGTCCGATCAGAATTGGGATATTTAATTCTTCGAACTGTGCTGGATGCTGGAAGATATCAAAGCCGTACTGATTTACTCAACTGAACGCATCGAAAGCGATCCAGAGCTATATCAATAAG

Full Affymetrix probeset data:

Annotations for 1633728_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime