FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633730_at:

>probe:Drosophila_2:1633730_at:139:91; Interrogation_Position=2089; Antisense; AGTTTTCCTCGAGTTTTGGCATTCG
>probe:Drosophila_2:1633730_at:257:165; Interrogation_Position=2122; Antisense; AAATCGAACGCCACTTTTGAGTCGT
>probe:Drosophila_2:1633730_at:675:277; Interrogation_Position=2153; Antisense; CTAGCTTCCAAACCCGTATTCTTAT
>probe:Drosophila_2:1633730_at:246:481; Interrogation_Position=2168; Antisense; GTATTCTTATCTTCGTCACCAGACT
>probe:Drosophila_2:1633730_at:251:163; Interrogation_Position=2319; Antisense; AAATCATAATTTCCCTTTCCTTGCT
>probe:Drosophila_2:1633730_at:407:693; Interrogation_Position=2334; Antisense; TTTCCTTGCTTAGTAACGTATTCCG
>probe:Drosophila_2:1633730_at:527:137; Interrogation_Position=2349; Antisense; ACGTATTCCGTATTCTGTAAGCCTA
>probe:Drosophila_2:1633730_at:346:493; Interrogation_Position=2365; Antisense; GTAAGCCTACAGTTTTTTGCCAATT
>probe:Drosophila_2:1633730_at:310:513; Interrogation_Position=2478; Antisense; GTGAGATTCGCATTATTCGCTAAAT
>probe:Drosophila_2:1633730_at:633:707; Interrogation_Position=2542; Antisense; TTACGAGCACGTTGTTTTCCTCATG
>probe:Drosophila_2:1633730_at:78:695; Interrogation_Position=2557; Antisense; TTTCCTCATGTCTTTCGCAACTATA
>probe:Drosophila_2:1633730_at:630:5; Interrogation_Position=2585; Antisense; ATTGATTCACCCTATTTAACACTCC
>probe:Drosophila_2:1633730_at:142:483; Interrogation_Position=2626; Antisense; GTATAGCTTAAGTTATCGCGCGGCA
>probe:Drosophila_2:1633730_at:458:299; Interrogation_Position=2642; Antisense; CGCGCGGCAATAAAGTCGTCACTAT

Paste this into a BLAST search page for me
AGTTTTCCTCGAGTTTTGGCATTCGAAATCGAACGCCACTTTTGAGTCGTCTAGCTTCCAAACCCGTATTCTTATGTATTCTTATCTTCGTCACCAGACTAAATCATAATTTCCCTTTCCTTGCTTTTCCTTGCTTAGTAACGTATTCCGACGTATTCCGTATTCTGTAAGCCTAGTAAGCCTACAGTTTTTTGCCAATTGTGAGATTCGCATTATTCGCTAAATTTACGAGCACGTTGTTTTCCTCATGTTTCCTCATGTCTTTCGCAACTATAATTGATTCACCCTATTTAACACTCCGTATAGCTTAAGTTATCGCGCGGCACGCGCGGCAATAAAGTCGTCACTAT

Full Affymetrix probeset data:

Annotations for 1633730_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720