FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633731_at:

>probe:Drosophila_2:1633731_at:477:253; Interrogation_Position=1894; Antisense; CAACGAGTCAATCTTCTTGCGGTGA
>probe:Drosophila_2:1633731_at:234:535; Interrogation_Position=1914; Antisense; GGTGACTAACAATCCGGACAGTCTG
>probe:Drosophila_2:1633731_at:389:267; Interrogation_Position=1932; Antisense; CAGTCTGGATGGACAGCGTTGCCTT
>probe:Drosophila_2:1633731_at:41:127; Interrogation_Position=1993; Antisense; AGCCATGGCAAGTTCGACAGCATAT
>probe:Drosophila_2:1633731_at:457:399; Interrogation_Position=2008; Antisense; GACAGCATATCCGATCGCAACAAGA
>probe:Drosophila_2:1633731_at:479:455; Interrogation_Position=2051; Antisense; GATAAGCTCGCAACAGATGCCGAAC
>probe:Drosophila_2:1633731_at:250:443; Interrogation_Position=2066; Antisense; GATGCCGAACCGATAGCTAAACTCT
>probe:Drosophila_2:1633731_at:55:117; Interrogation_Position=2080; Antisense; AGCTAAACTCTTCCGAATCGAACGT
>probe:Drosophila_2:1633731_at:600:651; Interrogation_Position=2114; Antisense; TCACATTGTGTTACCTTTTAAGCGT
>probe:Drosophila_2:1633731_at:707:271; Interrogation_Position=2155; Antisense; CATATTTCTAACTATTCGCTTTCGT
>probe:Drosophila_2:1633731_at:397:11; Interrogation_Position=2168; Antisense; ATTCGCTTTCGTTTAAGCTCATGGA
>probe:Drosophila_2:1633731_at:82:119; Interrogation_Position=2183; Antisense; AGCTCATGGATTTTGAAGCATTCGT
>probe:Drosophila_2:1633731_at:22:119; Interrogation_Position=2231; Antisense; AGCTCAGTGAACTTTTCCCTGTTAA
>probe:Drosophila_2:1633731_at:273:491; Interrogation_Position=2287; Antisense; GTAAACTTTAAGATTCTCGCATAGT

Paste this into a BLAST search page for me
CAACGAGTCAATCTTCTTGCGGTGAGGTGACTAACAATCCGGACAGTCTGCAGTCTGGATGGACAGCGTTGCCTTAGCCATGGCAAGTTCGACAGCATATGACAGCATATCCGATCGCAACAAGAGATAAGCTCGCAACAGATGCCGAACGATGCCGAACCGATAGCTAAACTCTAGCTAAACTCTTCCGAATCGAACGTTCACATTGTGTTACCTTTTAAGCGTCATATTTCTAACTATTCGCTTTCGTATTCGCTTTCGTTTAAGCTCATGGAAGCTCATGGATTTTGAAGCATTCGTAGCTCAGTGAACTTTTCCCTGTTAAGTAAACTTTAAGATTCTCGCATAGT

Full Affymetrix probeset data:

Annotations for 1633731_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720