Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633732_at:

>probe:Drosophila_2:1633732_at:325:483; Interrogation_Position=2827; Antisense; GTATACTTTGAGTCCTCCACGGTGG
>probe:Drosophila_2:1633732_at:652:505; Interrogation_Position=2904; Antisense; GTCCACACAGTCACCAAGCGAAATG
>probe:Drosophila_2:1633732_at:456:67; Interrogation_Position=2941; Antisense; ATGGCTCCATATCCCAACGAACTGG
>probe:Drosophila_2:1633732_at:601:541; Interrogation_Position=2964; Antisense; GGATCACATGCAGACCAATGCCCAG
>probe:Drosophila_2:1633732_at:708:603; Interrogation_Position=3011; Antisense; TGATTATAGCCATCACGGTGAGCGT
>probe:Drosophila_2:1633732_at:298:513; Interrogation_Position=3034; Antisense; GTGATTGGTGTGGTGGCCCTCATTC
>probe:Drosophila_2:1633732_at:714:519; Interrogation_Position=3064; Antisense; GTGGCATTCCTCTACTTGATGCGCA
>probe:Drosophila_2:1633732_at:20:377; Interrogation_Position=3096; Antisense; GAAGCAGACGTCCTACGGCCAAAGG
>probe:Drosophila_2:1633732_at:421:223; Interrogation_Position=3117; Antisense; AAGGTGTCGCCCTGTGAGCTTGGAT
>probe:Drosophila_2:1633732_at:122:287; Interrogation_Position=3151; Antisense; CTGGACAACGTTTCGGTGCTGGGCA
>probe:Drosophila_2:1633732_at:484:81; Interrogation_Position=3188; Antisense; AGGGTCGCGATATGAGAGCCTCCAA
>probe:Drosophila_2:1633732_at:495:565; Interrogation_Position=3223; Antisense; GGCAATGCAGCCTTCGATGATCCCT
>probe:Drosophila_2:1633732_at:689:261; Interrogation_Position=3305; Antisense; CAGACGTCTTCGAGGAGTTCCGGGA
>probe:Drosophila_2:1633732_at:549:219; Interrogation_Position=3359; Antisense; AAGTGCCACCTGGTTGTGAGGACAA

Paste this into a BLAST search page for me
GTATACTTTGAGTCCTCCACGGTGGGTCCACACAGTCACCAAGCGAAATGATGGCTCCATATCCCAACGAACTGGGGATCACATGCAGACCAATGCCCAGTGATTATAGCCATCACGGTGAGCGTGTGATTGGTGTGGTGGCCCTCATTCGTGGCATTCCTCTACTTGATGCGCAGAAGCAGACGTCCTACGGCCAAAGGAAGGTGTCGCCCTGTGAGCTTGGATCTGGACAACGTTTCGGTGCTGGGCAAGGGTCGCGATATGAGAGCCTCCAAGGCAATGCAGCCTTCGATGATCCCTCAGACGTCTTCGAGGAGTTCCGGGAAAGTGCCACCTGGTTGTGAGGACAA

Full Affymetrix probeset data:

Annotations for 1633732_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime