FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633734_at:

>probe:Drosophila_2:1633734_at:13:211; Interrogation_Position=3351; Antisense; AAGAAGCTGTACAAGACTGCGACCA
>probe:Drosophila_2:1633734_at:210:145; Interrogation_Position=3366; Antisense; ACTGCGACCAGCATCAGTGCTTTTT
>probe:Drosophila_2:1633734_at:52:87; Interrogation_Position=3381; Antisense; AGTGCTTTTTGCCAGTTGCTCCAGG
>probe:Drosophila_2:1633734_at:161:79; Interrogation_Position=3403; Antisense; AGGTTCCTCGCCTGTCTAAACGCAT
>probe:Drosophila_2:1633734_at:301:281; Interrogation_Position=3429; Antisense; CTCTCCAAGCTCTCAGTATTTCTTG
>probe:Drosophila_2:1633734_at:126:91; Interrogation_Position=3443; Antisense; AGTATTTCTTGGACTGCAGCACGTC
>probe:Drosophila_2:1633734_at:234:179; Interrogation_Position=3477; Antisense; AAAACCGCTGCCACAAAATTGTACG
>probe:Drosophila_2:1633734_at:371:5; Interrogation_Position=3494; Antisense; ATTGTACGAAGCGTTGGCTCTGCAC
>probe:Drosophila_2:1633734_at:696:441; Interrogation_Position=3522; Antisense; GATGTCACCGAAGTGCCCGAGGAGA
>probe:Drosophila_2:1633734_at:552:65; Interrogation_Position=3549; Antisense; ATGGATGAGATCCTAACACTGCTCT
>probe:Drosophila_2:1633734_at:385:157; Interrogation_Position=3564; Antisense; ACACTGCTCTCCGAAACGGACTGGA
>probe:Drosophila_2:1633734_at:432:335; Interrogation_Position=3614; Antisense; GCTGCGGAACCAGTTGTGCCAACTA
>probe:Drosophila_2:1633734_at:154:657; Interrogation_Position=3637; Antisense; TAATGGACATCAAGCCTCCCGTAAG
>probe:Drosophila_2:1633734_at:638:617; Interrogation_Position=3674; Antisense; TGCAGCCGCTTTGCAGCAAGCGAGT

Paste this into a BLAST search page for me
AAGAAGCTGTACAAGACTGCGACCAACTGCGACCAGCATCAGTGCTTTTTAGTGCTTTTTGCCAGTTGCTCCAGGAGGTTCCTCGCCTGTCTAAACGCATCTCTCCAAGCTCTCAGTATTTCTTGAGTATTTCTTGGACTGCAGCACGTCAAAACCGCTGCCACAAAATTGTACGATTGTACGAAGCGTTGGCTCTGCACGATGTCACCGAAGTGCCCGAGGAGAATGGATGAGATCCTAACACTGCTCTACACTGCTCTCCGAAACGGACTGGAGCTGCGGAACCAGTTGTGCCAACTATAATGGACATCAAGCCTCCCGTAAGTGCAGCCGCTTTGCAGCAAGCGAGT

Full Affymetrix probeset data:

Annotations for 1633734_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720