Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633736_at:

>probe:Drosophila_2:1633736_at:636:433; Interrogation_Position=2089; Antisense; GAGGAAAATCGATCCACCAGTTATT
>probe:Drosophila_2:1633736_at:619:423; Interrogation_Position=2162; Antisense; GAGAAACTCGGCTACAACTCGTGCA
>probe:Drosophila_2:1633736_at:647:481; Interrogation_Position=2221; Antisense; GTATGCTTTGGCTGCTTTGAAGTCA
>probe:Drosophila_2:1633736_at:723:575; Interrogation_Position=2246; Antisense; GGCGCAAAGGACATCCTGGTGGCCA
>probe:Drosophila_2:1633736_at:218:503; Interrogation_Position=2276; Antisense; GTCGCTGGTCGTGGTATCGACATCA
>probe:Drosophila_2:1633736_at:98:555; Interrogation_Position=2302; Antisense; GGACGTGTCCTTGGTTATTAACTAT
>probe:Drosophila_2:1633736_at:485:543; Interrogation_Position=2347; Antisense; GGATTACACACATCGTATCGGTCGT
>probe:Drosophila_2:1633736_at:248:355; Interrogation_Position=2385; Antisense; GCAAAACCGGTTGTGCCATTTCGTT
>probe:Drosophila_2:1633736_at:205:627; Interrogation_Position=2398; Antisense; TGCCATTTCGTTTGTCACCAAGGAC
>probe:Drosophila_2:1633736_at:237:457; Interrogation_Position=2423; Antisense; GATAGCGCTTTGTTCTACGATCTAA
>probe:Drosophila_2:1633736_at:125:231; Interrogation_Position=2451; Antisense; AATGTGTGTCTGCAAGTCCTGTCTC
>probe:Drosophila_2:1633736_at:657:597; Interrogation_Position=2480; Antisense; TGTCCGCCGGAGCTAATGAATCACC
>probe:Drosophila_2:1633736_at:518:159; Interrogation_Position=2517; Antisense; ACAAGCCTGGCACGGTGGTTACCAA
>probe:Drosophila_2:1633736_at:99:729; Interrogation_Position=2627; Antisense; TTGGGTGCGCCAAAGCCATACCTTG

Paste this into a BLAST search page for me
GAGGAAAATCGATCCACCAGTTATTGAGAAACTCGGCTACAACTCGTGCAGTATGCTTTGGCTGCTTTGAAGTCAGGCGCAAAGGACATCCTGGTGGCCAGTCGCTGGTCGTGGTATCGACATCAGGACGTGTCCTTGGTTATTAACTATGGATTACACACATCGTATCGGTCGTGCAAAACCGGTTGTGCCATTTCGTTTGCCATTTCGTTTGTCACCAAGGACGATAGCGCTTTGTTCTACGATCTAAAATGTGTGTCTGCAAGTCCTGTCTCTGTCCGCCGGAGCTAATGAATCACCACAAGCCTGGCACGGTGGTTACCAATTGGGTGCGCCAAAGCCATACCTTG

Full Affymetrix probeset data:

Annotations for 1633736_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime