FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633738_at:

>probe:Drosophila_2:1633738_at:554:377; Interrogation_Position=1007; Antisense; GAAGCTTGAACACTATGCCATCGGT
>probe:Drosophila_2:1633738_at:504:581; Interrogation_Position=1031; Antisense; TGGCCCATGCTGTGTACTTTTACTT
>probe:Drosophila_2:1633738_at:3:701; Interrogation_Position=1048; Antisense; TTTTACTTCTCGCTCATCTTTCTAA
>probe:Drosophila_2:1633738_at:454:37; Interrogation_Position=1063; Antisense; ATCTTTCTAATTGGTCGCACTCTGG
>probe:Drosophila_2:1633738_at:533:489; Interrogation_Position=1098; Antisense; GTACTCCTCGAGTGTTCATGATGAA
>probe:Drosophila_2:1633738_at:278:693; Interrogation_Position=1134; Antisense; TTTGAGATATCTGCGCTGTGTGCCC
>probe:Drosophila_2:1633738_at:654:345; Interrogation_Position=1229; Antisense; GCATGAAGTTTTTCCACCTCACAAG
>probe:Drosophila_2:1633738_at:297:517; Interrogation_Position=1268; Antisense; GTGTGGCTGGAACCATCGTCACGTA
>probe:Drosophila_2:1633738_at:612:159; Interrogation_Position=1322; Antisense; ACAACGACCTGTGGGACTGCGATCA
>probe:Drosophila_2:1633738_at:146:269; Interrogation_Position=801; Antisense; CATTGGACTGGCTTCGAAGTTTCGC
>probe:Drosophila_2:1633738_at:63:375; Interrogation_Position=816; Antisense; GAAGTTTCGCCAGCTCAACGATGAT
>probe:Drosophila_2:1633738_at:378:25; Interrogation_Position=863; Antisense; ATATGGCTCCATCTTACTGGTCAGA
>probe:Drosophila_2:1633738_at:167:31; Interrogation_Position=952; Antisense; ATAACAATGGTGTCCTTCTCCAACA
>probe:Drosophila_2:1633738_at:596:697; Interrogation_Position=984; Antisense; TTTCATTTGCGTCCAGTTGCTGAGA

Paste this into a BLAST search page for me
GAAGCTTGAACACTATGCCATCGGTTGGCCCATGCTGTGTACTTTTACTTTTTTACTTCTCGCTCATCTTTCTAAATCTTTCTAATTGGTCGCACTCTGGGTACTCCTCGAGTGTTCATGATGAATTTGAGATATCTGCGCTGTGTGCCCGCATGAAGTTTTTCCACCTCACAAGGTGTGGCTGGAACCATCGTCACGTAACAACGACCTGTGGGACTGCGATCACATTGGACTGGCTTCGAAGTTTCGCGAAGTTTCGCCAGCTCAACGATGATATATGGCTCCATCTTACTGGTCAGAATAACAATGGTGTCCTTCTCCAACATTTCATTTGCGTCCAGTTGCTGAGA

Full Affymetrix probeset data:

Annotations for 1633738_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720