FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633739_at:

>probe:Drosophila_2:1633739_at:328:577; Interrogation_Position=1027; Antisense; GGCCAATGTAACTTTGTTTCGGGAT
>probe:Drosophila_2:1633739_at:86:455; Interrogation_Position=1049; Antisense; GATACGGACGGCACAACTTCCACTT
>probe:Drosophila_2:1633739_at:301:505; Interrogation_Position=1109; Antisense; GTCCAGCCTGCGGAGGTTCAACATA
>probe:Drosophila_2:1633739_at:670:57; Interrogation_Position=1134; Antisense; ATGATGTGATCTACGCTCTGTTGCA
>probe:Drosophila_2:1633739_at:397:3; Interrogation_Position=1159; Antisense; ATTCGAAAGTCCTGTTCTATCTCCG
>probe:Drosophila_2:1633739_at:596:309; Interrogation_Position=1184; Antisense; CCACATTCAACGCTGATTGCTTCGA
>probe:Drosophila_2:1633739_at:455:723; Interrogation_Position=1200; Antisense; TTGCTTCGAAGCTGGACATGGATGT
>probe:Drosophila_2:1633739_at:436:547; Interrogation_Position=1219; Antisense; GGATGTCCATAGTACCAGTTGTAGA
>probe:Drosophila_2:1633739_at:131:569; Interrogation_Position=1269; Antisense; GGCAGACGCACAGTTCCAAATACTT
>probe:Drosophila_2:1633739_at:689:381; Interrogation_Position=1301; Antisense; GAACTGCCGAAACTGCGGATTTTCA
>probe:Drosophila_2:1633739_at:674:525; Interrogation_Position=1342; Antisense; GGGAAGCATTCAGCGAGTGGTCAAT
>probe:Drosophila_2:1633739_at:370:5; Interrogation_Position=1463; Antisense; ATTGAACGCACCTTTGGCCAGACAT
>probe:Drosophila_2:1633739_at:636:339; Interrogation_Position=1496; Antisense; GCTATAACTTTTCAGGACGCCCTAT
>probe:Drosophila_2:1633739_at:227:189; Interrogation_Position=1590; Antisense; AACAGGCAGGCTTGTTTCAATGACA

Paste this into a BLAST search page for me
GGCCAATGTAACTTTGTTTCGGGATGATACGGACGGCACAACTTCCACTTGTCCAGCCTGCGGAGGTTCAACATAATGATGTGATCTACGCTCTGTTGCAATTCGAAAGTCCTGTTCTATCTCCGCCACATTCAACGCTGATTGCTTCGATTGCTTCGAAGCTGGACATGGATGTGGATGTCCATAGTACCAGTTGTAGAGGCAGACGCACAGTTCCAAATACTTGAACTGCCGAAACTGCGGATTTTCAGGGAAGCATTCAGCGAGTGGTCAATATTGAACGCACCTTTGGCCAGACATGCTATAACTTTTCAGGACGCCCTATAACAGGCAGGCTTGTTTCAATGACA

Full Affymetrix probeset data:

Annotations for 1633739_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720