FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633740_at:

>probe:Drosophila_2:1633740_at:174:529; Interrogation_Position=1056; Antisense; GGGAGTTCTTATGGCCTGAATCTTT
>probe:Drosophila_2:1633740_at:691:239; Interrogation_Position=1135; Antisense; AATAAGATTTTCCATCATCGCATTG
>probe:Drosophila_2:1633740_at:693:131; Interrogation_Position=566; Antisense; ACCGATACGCTGCTATCCAAGCTGG
>probe:Drosophila_2:1633740_at:113:69; Interrogation_Position=597; Antisense; ATGGCTTCTCCGTGGATGCGTGCGA
>probe:Drosophila_2:1633740_at:372:373; Interrogation_Position=620; Antisense; GAAGTGTACGAGACGCGCTGTCATC
>probe:Drosophila_2:1633740_at:680:599; Interrogation_Position=638; Antisense; TGTCATCCCGAATTGGGCGCCAATG
>probe:Drosophila_2:1633740_at:375:465; Interrogation_Position=694; Antisense; GATTGAATTTCTTGCCTTCTTCTCG
>probe:Drosophila_2:1633740_at:460:313; Interrogation_Position=718; Antisense; GCCATCGGGCGTCAATTGTGCACAG
>probe:Drosophila_2:1633740_at:458:727; Interrogation_Position=733; Antisense; TTGTGCACAGCAGTACTTCACCAGC
>probe:Drosophila_2:1633740_at:303:45; Interrogation_Position=823; Antisense; ATCGCTGGGCCAAAAGGTTTACTGC
>probe:Drosophila_2:1633740_at:391:591; Interrogation_Position=876; Antisense; TGGTCAAGGTGCTGCTCAATCCGCA
>probe:Drosophila_2:1633740_at:545:619; Interrogation_Position=888; Antisense; TGCTCAATCCGCAGGACAGTCGGGA
>probe:Drosophila_2:1633740_at:657:577; Interrogation_Position=940; Antisense; GGCCGCCATCGAGAATAACAATTAA
>probe:Drosophila_2:1633740_at:629:571; Interrogation_Position=998; Antisense; GGCTAATCTCCACAAATCATCATCG

Paste this into a BLAST search page for me
GGGAGTTCTTATGGCCTGAATCTTTAATAAGATTTTCCATCATCGCATTGACCGATACGCTGCTATCCAAGCTGGATGGCTTCTCCGTGGATGCGTGCGAGAAGTGTACGAGACGCGCTGTCATCTGTCATCCCGAATTGGGCGCCAATGGATTGAATTTCTTGCCTTCTTCTCGGCCATCGGGCGTCAATTGTGCACAGTTGTGCACAGCAGTACTTCACCAGCATCGCTGGGCCAAAAGGTTTACTGCTGGTCAAGGTGCTGCTCAATCCGCATGCTCAATCCGCAGGACAGTCGGGAGGCCGCCATCGAGAATAACAATTAAGGCTAATCTCCACAAATCATCATCG

Full Affymetrix probeset data:

Annotations for 1633740_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720