FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633741_at:

>probe:Drosophila_2:1633741_at:48:383; Interrogation_Position=234; Antisense; GAACGCTCTTGATGTGTTCAGCGCA
>probe:Drosophila_2:1633741_at:204:471; Interrogation_Position=249; Antisense; GTTCAGCGCAGAGCACCAATCAGTA
>probe:Drosophila_2:1633741_at:213:299; Interrogation_Position=293; Antisense; GCGAAACGGACCATCGGACTCAAAT
>probe:Drosophila_2:1633741_at:101:447; Interrogation_Position=343; Antisense; GATGCATCTGTCTATTTAGGCCTGG
>probe:Drosophila_2:1633741_at:119:429; Interrogation_Position=377; Antisense; GAGTTGATCCAGGACAACCCGACAA
>probe:Drosophila_2:1633741_at:452:397; Interrogation_Position=397; Antisense; GACAATGGCCCTGGTAGACGAGCGC
>probe:Drosophila_2:1633741_at:509:141; Interrogation_Position=429; Antisense; ACGGCTGCTTGCTCTTCGAAAAGTG
>probe:Drosophila_2:1633741_at:87:345; Interrogation_Position=529; Antisense; GCTTGACTCCTCATTTGTTATTCGA
>probe:Drosophila_2:1633741_at:524:605; Interrogation_Position=564; Antisense; TGATCAGGTGCTAGGACGGCTTCTC
>probe:Drosophila_2:1633741_at:530:139; Interrogation_Position=579; Antisense; ACGGCTTCTCTAAGATCTTCCTAGA
>probe:Drosophila_2:1633741_at:725:705; Interrogation_Position=620; Antisense; TTAGCCGACGCATGGGATGGACTAT
>probe:Drosophila_2:1633741_at:220:345; Interrogation_Position=645; Antisense; GCATTAAGCTTGTTCACGCCAGCGA
>probe:Drosophila_2:1633741_at:259:127; Interrogation_Position=660; Antisense; ACGCCAGCGAAATACCCAGTTCAAG
>probe:Drosophila_2:1633741_at:465:79; Interrogation_Position=677; Antisense; AGTTCAAGTCAAGCGGCCCGTTTTG

Paste this into a BLAST search page for me
GAACGCTCTTGATGTGTTCAGCGCAGTTCAGCGCAGAGCACCAATCAGTAGCGAAACGGACCATCGGACTCAAATGATGCATCTGTCTATTTAGGCCTGGGAGTTGATCCAGGACAACCCGACAAGACAATGGCCCTGGTAGACGAGCGCACGGCTGCTTGCTCTTCGAAAAGTGGCTTGACTCCTCATTTGTTATTCGATGATCAGGTGCTAGGACGGCTTCTCACGGCTTCTCTAAGATCTTCCTAGATTAGCCGACGCATGGGATGGACTATGCATTAAGCTTGTTCACGCCAGCGAACGCCAGCGAAATACCCAGTTCAAGAGTTCAAGTCAAGCGGCCCGTTTTG

Full Affymetrix probeset data:

Annotations for 1633741_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720