Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633743_at:

>probe:Drosophila_2:1633743_at:95:187; Interrogation_Position=123; Antisense; AACAACATGCTGTACCCCAAGGAGG
>probe:Drosophila_2:1633743_at:10:673; Interrogation_Position=171; Antisense; TACGCCTGCCGGAATTGCGATTACA
>probe:Drosophila_2:1633743_at:131:557; Interrogation_Position=206; Antisense; GGACTCCAACTGCATCTACGTGAAC
>probe:Drosophila_2:1633743_at:549:425; Interrogation_Position=243; Antisense; GAGATCGACGAGCTGACCCACATTG
>probe:Drosophila_2:1633743_at:287:149; Interrogation_Position=262; Antisense; ACATTGTGCCCGACGTGATTTCCGA
>probe:Drosophila_2:1633743_at:531:375; Interrogation_Position=306; Antisense; GAAGACCACGCTTGTCCCAAGTGCT
>probe:Drosophila_2:1633743_at:613:439; Interrogation_Position=339; Antisense; GAGGCGGTCTTCTTCCAGGCGCAAA
>probe:Drosophila_2:1633743_at:74:325; Interrogation_Position=386; Antisense; GCGACTGTACTACGTGTGCACCAAC
>probe:Drosophila_2:1633743_at:9:109; Interrogation_Position=412; Antisense; AGAACTGCACCCACCGTTGGACGGA
>probe:Drosophila_2:1633743_at:641:427; Interrogation_Position=435; Antisense; GAGTAGAAACTGACGACCCATCTGC
>probe:Drosophila_2:1633743_at:58:39; Interrogation_Position=454; Antisense; ATCTGCCTCTAATTGTAGCCCTAAG
>probe:Drosophila_2:1633743_at:505:483; Interrogation_Position=478; Antisense; GTAATCGAAGGCACTTTGCAATCGT
>probe:Drosophila_2:1633743_at:465:11; Interrogation_Position=556; Antisense; ATTCTCGGTTGTCGCCTAATGTAAT
>probe:Drosophila_2:1633743_at:699:449; Interrogation_Position=609; Antisense; GATCCGCATGACTTTGAATCACTTG

Paste this into a BLAST search page for me
AACAACATGCTGTACCCCAAGGAGGTACGCCTGCCGGAATTGCGATTACAGGACTCCAACTGCATCTACGTGAACGAGATCGACGAGCTGACCCACATTGACATTGTGCCCGACGTGATTTCCGAGAAGACCACGCTTGTCCCAAGTGCTGAGGCGGTCTTCTTCCAGGCGCAAAGCGACTGTACTACGTGTGCACCAACAGAACTGCACCCACCGTTGGACGGAGAGTAGAAACTGACGACCCATCTGCATCTGCCTCTAATTGTAGCCCTAAGGTAATCGAAGGCACTTTGCAATCGTATTCTCGGTTGTCGCCTAATGTAATGATCCGCATGACTTTGAATCACTTG

Full Affymetrix probeset data:

Annotations for 1633743_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime