FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633748_at:

>probe:Drosophila_2:1633748_at:379:211; Interrogation_Position=103; Antisense; AAGACCATGCCGGTGTACGATTACC
>probe:Drosophila_2:1633748_at:589:707; Interrogation_Position=123; Antisense; TTACCGTTGCCAAAATCCGCCAAAG
>probe:Drosophila_2:1633748_at:9:395; Interrogation_Position=283; Antisense; GAAATGATGCACATTGCGGCTCCTC
>probe:Drosophila_2:1633748_at:665:339; Interrogation_Position=308; Antisense; GCTACGACATGGATCGCTACGGTGT
>probe:Drosophila_2:1633748_at:292:671; Interrogation_Position=325; Antisense; TACGGTGTGGTGTTCCGAGCATCTC
>probe:Drosophila_2:1633748_at:543:317; Interrogation_Position=376; Antisense; GCCGGAACCCTGACCAACAAGATGG
>probe:Drosophila_2:1633748_at:677:439; Interrogation_Position=396; Antisense; GATGGCACCGGCCTTTCGGAAGATC
>probe:Drosophila_2:1633748_at:236:447; Interrogation_Position=429; Antisense; GATGCCCGAGCCGAGATGGGTCATT
>probe:Drosophila_2:1633748_at:187:531; Interrogation_Position=446; Antisense; GGGTCATTTCCATGGGCAGTTGCGC
>probe:Drosophila_2:1633748_at:485:229; Interrogation_Position=472; Antisense; AATGGTGGCGGCTACTACCACTACT
>probe:Drosophila_2:1633748_at:231:327; Interrogation_Position=518; Antisense; GCGATCGCATTGTTCCGGTGGACAT
>probe:Drosophila_2:1633748_at:299:577; Interrogation_Position=573; Antisense; GGCCTTAATGTACGGAATCCTGCAG
>probe:Drosophila_2:1633748_at:670:205; Interrogation_Position=613; Antisense; AAGCGCATGAGGACCCTGCAGATGT
>probe:Drosophila_2:1633748_at:41:589; Interrogation_Position=69; Antisense; TGGAGTGCTGCAATCCCAGTGGCTT

Paste this into a BLAST search page for me
AAGACCATGCCGGTGTACGATTACCTTACCGTTGCCAAAATCCGCCAAAGGAAATGATGCACATTGCGGCTCCTCGCTACGACATGGATCGCTACGGTGTTACGGTGTGGTGTTCCGAGCATCTCGCCGGAACCCTGACCAACAAGATGGGATGGCACCGGCCTTTCGGAAGATCGATGCCCGAGCCGAGATGGGTCATTGGGTCATTTCCATGGGCAGTTGCGCAATGGTGGCGGCTACTACCACTACTGCGATCGCATTGTTCCGGTGGACATGGCCTTAATGTACGGAATCCTGCAGAAGCGCATGAGGACCCTGCAGATGTTGGAGTGCTGCAATCCCAGTGGCTT

Full Affymetrix probeset data:

Annotations for 1633748_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720