FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633749_at:

>probe:Drosophila_2:1633749_at:462:299; Interrogation_Position=1044; Antisense; CCCAGTGCGCTTGCCTAAGAAGGAT
>probe:Drosophila_2:1633749_at:534:399; Interrogation_Position=617; Antisense; GACAGATGCGTATCTCTATCCGGAG
>probe:Drosophila_2:1633749_at:624:611; Interrogation_Position=667; Antisense; TGAAAACGCCGGGTATGTGCCAGCC
>probe:Drosophila_2:1633749_at:183:271; Interrogation_Position=694; Antisense; CATCCTCTGTGTCAGTGGGCGTGAA
>probe:Drosophila_2:1633749_at:207:129; Interrogation_Position=717; Antisense; AAGTTGGCCGGCTATTCCACGGTGG
>probe:Drosophila_2:1633749_at:17:607; Interrogation_Position=752; Antisense; TGATGCCGCCGTAATGCGTTACGTA
>probe:Drosophila_2:1633749_at:362:707; Interrogation_Position=770; Antisense; TTACGTATCGAATGGATTCCCCGTC
>probe:Drosophila_2:1633749_at:235:11; Interrogation_Position=785; Antisense; ATTCCCCGTCATAGTCGAGTACAAT
>probe:Drosophila_2:1633749_at:368:45; Interrogation_Position=808; Antisense; ATCCGGCTACCTTTGGATTCATGCA
>probe:Drosophila_2:1633749_at:243:463; Interrogation_Position=823; Antisense; GATTCATGCAGTACTCCAGTGGCGT
>probe:Drosophila_2:1633749_at:602:629; Interrogation_Position=837; Antisense; TCCAGTGGCGTCTATGTCCAGGAGA
>probe:Drosophila_2:1633749_at:152:173; Interrogation_Position=881; Antisense; AAAGAGCTCACAGTTCCTGGTGGTC
>probe:Drosophila_2:1633749_at:290:137; Interrogation_Position=919; Antisense; ACGACGTGGACTCCAATCTGGACTA
>probe:Drosophila_2:1633749_at:402:475; Interrogation_Position=988; Antisense; GTTACATCAGGATCGTGCGCAGGTC

Paste this into a BLAST search page for me
CCCAGTGCGCTTGCCTAAGAAGGATGACAGATGCGTATCTCTATCCGGAGTGAAAACGCCGGGTATGTGCCAGCCCATCCTCTGTGTCAGTGGGCGTGAAAAGTTGGCCGGCTATTCCACGGTGGTGATGCCGCCGTAATGCGTTACGTATTACGTATCGAATGGATTCCCCGTCATTCCCCGTCATAGTCGAGTACAATATCCGGCTACCTTTGGATTCATGCAGATTCATGCAGTACTCCAGTGGCGTTCCAGTGGCGTCTATGTCCAGGAGAAAAGAGCTCACAGTTCCTGGTGGTCACGACGTGGACTCCAATCTGGACTAGTTACATCAGGATCGTGCGCAGGTC

Full Affymetrix probeset data:

Annotations for 1633749_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720