FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633751_at:

>probe:Drosophila_2:1633751_at:175:25; Interrogation_Position=1077; Antisense; ATATGTATAAGTCCCGCTGCTATTC
>probe:Drosophila_2:1633751_at:672:503; Interrogation_Position=1087; Antisense; GTCCCGCTGCTATTCATCTTAAGTA
>probe:Drosophila_2:1633751_at:540:205; Interrogation_Position=539; Antisense; AAGCGCCTGCTGAAGTTCTTTACCA
>probe:Drosophila_2:1633751_at:309:695; Interrogation_Position=557; Antisense; TTTACCACCTTGTTTTCCTGTCTGA
>probe:Drosophila_2:1633751_at:202:323; Interrogation_Position=590; Antisense; GCGCGAGCTGTCTTTCAATTTTATC
>probe:Drosophila_2:1633751_at:204:427; Interrogation_Position=635; Antisense; GAGATGGTAACCTCGCAAGCCATGA
>probe:Drosophila_2:1633751_at:463:277; Interrogation_Position=670; Antisense; CTACGGAGGATTGGTTGTCGACTAT
>probe:Drosophila_2:1633751_at:3:401; Interrogation_Position=689; Antisense; GACTATCCAAACTCTGCCAAGGCTA
>probe:Drosophila_2:1633751_at:507:489; Interrogation_Position=718; Antisense; GTACTACCTGGTGCTCATGACTGGA
>probe:Drosophila_2:1633751_at:178:569; Interrogation_Position=763; Antisense; GGCTTTGGGCTCACCTGAAGAGGAA
>probe:Drosophila_2:1633751_at:420:177; Interrogation_Position=809; Antisense; AAACGTGATGCTTGCCGTGAGGCTC
>probe:Drosophila_2:1633751_at:692:97; Interrogation_Position=849; Antisense; AGAAATCCCGCGATTGGATCCTAGC
>probe:Drosophila_2:1633751_at:204:715; Interrogation_Position=902; Antisense; TTGGAAACCCGTCCTGACACAAAGT
>probe:Drosophila_2:1633751_at:486:413; Interrogation_Position=989; Antisense; GACCTAATCTCTAATTGCGGCTTTG

Paste this into a BLAST search page for me
ATATGTATAAGTCCCGCTGCTATTCGTCCCGCTGCTATTCATCTTAAGTAAAGCGCCTGCTGAAGTTCTTTACCATTTACCACCTTGTTTTCCTGTCTGAGCGCGAGCTGTCTTTCAATTTTATCGAGATGGTAACCTCGCAAGCCATGACTACGGAGGATTGGTTGTCGACTATGACTATCCAAACTCTGCCAAGGCTAGTACTACCTGGTGCTCATGACTGGAGGCTTTGGGCTCACCTGAAGAGGAAAAACGTGATGCTTGCCGTGAGGCTCAGAAATCCCGCGATTGGATCCTAGCTTGGAAACCCGTCCTGACACAAAGTGACCTAATCTCTAATTGCGGCTTTG

Full Affymetrix probeset data:

Annotations for 1633751_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720