FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633752_at:

>probe:Drosophila_2:1633752_at:168:113; Interrogation_Position=1032; Antisense; AGCACCATGTCGTTCTCCAAAAGAA
>probe:Drosophila_2:1633752_at:383:211; Interrogation_Position=1052; Antisense; AAGAACTGCCTCTCGGGAAAGCATT
>probe:Drosophila_2:1633752_at:236:173; Interrogation_Position=1069; Antisense; AAAGCATTCGCTCAATGGCCTTTCT
>probe:Drosophila_2:1633752_at:48:315; Interrogation_Position=1110; Antisense; GCCTACAATCTGAATTACCACACGC
>probe:Drosophila_2:1633752_at:300:319; Interrogation_Position=1136; Antisense; GCCCGACTCGGAGACGACCATGTAA
>probe:Drosophila_2:1633752_at:174:339; Interrogation_Position=574; Antisense; GCTACCGCAAAAACATTCCGCTGGA
>probe:Drosophila_2:1633752_at:417:333; Interrogation_Position=593; Antisense; GCTGGATCCCATTTACTACAATACC
>probe:Drosophila_2:1633752_at:470:27; Interrogation_Position=613; Antisense; ATACCAACGGTCTAGGAGCGCTGGA
>probe:Drosophila_2:1633752_at:286:537; Interrogation_Position=765; Antisense; GGTCACGCTCCCGATGAAGTATACA
>probe:Drosophila_2:1633752_at:450:373; Interrogation_Position=780; Antisense; GAAGTATACAACAATCGACCGCCCT
>probe:Drosophila_2:1633752_at:650:637; Interrogation_Position=804; Antisense; TCGGTGCGCTCCAGTTACTCGAATT
>probe:Drosophila_2:1633752_at:577:145; Interrogation_Position=820; Antisense; ACTCGAATTTTCATGGCTCACGGCC
>probe:Drosophila_2:1633752_at:370:303; Interrogation_Position=853; Antisense; CCGCTTACGGGAATGCCACTGGTGA
>probe:Drosophila_2:1633752_at:501:367; Interrogation_Position=878; Antisense; GAATGTATTCGCTGGACTGAACGGA

Paste this into a BLAST search page for me
AGCACCATGTCGTTCTCCAAAAGAAAAGAACTGCCTCTCGGGAAAGCATTAAAGCATTCGCTCAATGGCCTTTCTGCCTACAATCTGAATTACCACACGCGCCCGACTCGGAGACGACCATGTAAGCTACCGCAAAAACATTCCGCTGGAGCTGGATCCCATTTACTACAATACCATACCAACGGTCTAGGAGCGCTGGAGGTCACGCTCCCGATGAAGTATACAGAAGTATACAACAATCGACCGCCCTTCGGTGCGCTCCAGTTACTCGAATTACTCGAATTTTCATGGCTCACGGCCCCGCTTACGGGAATGCCACTGGTGAGAATGTATTCGCTGGACTGAACGGA

Full Affymetrix probeset data:

Annotations for 1633752_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720