Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633753_at:

>probe:Drosophila_2:1633753_at:587:703; Interrogation_Position=4059; Antisense; TTAGTGTCTGCACGCCCGAGTTTTG
>probe:Drosophila_2:1633753_at:103:305; Interrogation_Position=4074; Antisense; CCGAGTTTTGCTATGCGCTCAGAAA
>probe:Drosophila_2:1633753_at:472:49; Interrogation_Position=4086; Antisense; ATGCGCTCAGAAACCTAGTCTTAAG
>probe:Drosophila_2:1633753_at:509:449; Interrogation_Position=4111; Antisense; GATCGAAGGATAACTGCGCCTGTTT
>probe:Drosophila_2:1633753_at:263:317; Interrogation_Position=4128; Antisense; GCCTGTTTAACATGCGCATTGCGCA
>probe:Drosophila_2:1633753_at:172:297; Interrogation_Position=4149; Antisense; CGCACTTGGTGGCACACAGAATGAA
>probe:Drosophila_2:1633753_at:494:209; Interrogation_Position=4177; Antisense; AAGCAGCTACTGTACAAACACAATG
>probe:Drosophila_2:1633753_at:520:291; Interrogation_Position=4222; Antisense; CGTGAATAGTATTGCGTGGTGCTGC
>probe:Drosophila_2:1633753_at:434:291; Interrogation_Position=4236; Antisense; CGTGGTGCTGCATATTTTTAGGTAT
>probe:Drosophila_2:1633753_at:316:175; Interrogation_Position=4302; Antisense; AAACCAGTTGAAGCATTTCTAGGAT
>probe:Drosophila_2:1633753_at:39:679; Interrogation_Position=4327; Antisense; TAGATCATTTCAACCTTCGTCAGCA
>probe:Drosophila_2:1633753_at:372:683; Interrogation_Position=4411; Antisense; TATGCATCACACAAAACAACGAGCG
>probe:Drosophila_2:1633753_at:580:127; Interrogation_Position=4506; Antisense; ACCACCCACATATTTTATCACAAGC
>probe:Drosophila_2:1633753_at:525:147; Interrogation_Position=4584; Antisense; ACTAGCCATTTAAGCTTTGATGCAT

Paste this into a BLAST search page for me
TTAGTGTCTGCACGCCCGAGTTTTGCCGAGTTTTGCTATGCGCTCAGAAAATGCGCTCAGAAACCTAGTCTTAAGGATCGAAGGATAACTGCGCCTGTTTGCCTGTTTAACATGCGCATTGCGCACGCACTTGGTGGCACACAGAATGAAAAGCAGCTACTGTACAAACACAATGCGTGAATAGTATTGCGTGGTGCTGCCGTGGTGCTGCATATTTTTAGGTATAAACCAGTTGAAGCATTTCTAGGATTAGATCATTTCAACCTTCGTCAGCATATGCATCACACAAAACAACGAGCGACCACCCACATATTTTATCACAAGCACTAGCCATTTAAGCTTTGATGCAT

Full Affymetrix probeset data:

Annotations for 1633753_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime